Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5360Btlr/Mmmh
Stock Number:
042939-MU
Citation ID:
RRID:MMRRC_042939-MU
Other Names:
R5360 (G1), C57BL/6J-MtgxR5360Btlr
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
Ppp2r2a
Name: protein phosphatase 2, regulatory subunit B, alpha
Synonyms: 2410004D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71978
VEGA: 14
HGNC: HGNC:9304
Homologene: 2035
Otx1
Name: orthodenticle homeobox 1
Synonyms: A730044F23Rik, jv
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18423
HGNC: HGNC:8521
Homologene: 7875
Ilrun
Name: inflammation and lipid regulator with UBA-like and NBR1-like domains
Synonyms: D17Wsu92e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224647
Homologene: 32575
Rps8
Name: ribosomal protein S8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20116
Homologene: 133143
Mdm4
Name: transformed mouse 3T3 cell double minute 4
Synonyms: Mdmx, 4933417N07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17248
HGNC: HGNC:6974
Homologene: 1794
Gnaq
Name: guanine nucleotide binding protein, alpha q polypeptide
Synonyms: G alpha q, Gq, Galphaq, 6230401I02Rik, 1110005L02Rik, Dsk10, Dsk1, GqI
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14682
HGNC: HGNC:4390
Homologene: 1566
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: Rnf164, D930043C02Rik, 2900024N03Rik, 9430019J22Rik, Mnab
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319817
Homologene: 28276
Ttc39b
Name: tetratricopeptide repeat domain 39B
Synonyms: 9130422G05Rik, 1810054D07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69863
Homologene: 25228
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: TSC-22, Egr5, Tgfb1i4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Arhgap32
Name: Rho GTPase activating protein 32
Synonyms: p200RhoGAP, GC-GAP, PX-RICS, 3426406O18Rik, Grit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330914
Homologene: 8812
Cacnb1
Name: calcium channel, voltage-dependent, beta 1 subunit
Synonyms: Cchlb1, Cchb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12295
HGNC: HGNC:1401
Homologene: 20186
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Melk
Name: maternal embryonic leucine zipper kinase
Synonyms: MPK38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17279
Homologene: 32111
Cntn2
Name: contactin 2
Synonyms: Tax, TAG-1, axonin, D130012K04Rik, TAG1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21367
HGNC: HGNC:2172
Homologene: 3720
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64706
Homologene: 11224
Polr2b
Name: polymerase (RNA) II (DNA directed) polypeptide B
Synonyms: RPB2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231329
HGNC: HGNC:9188
Homologene: 722
Spag5
Name: sperm associated antigen 5
Synonyms: MAP126, Astrin, s17, S17, Mastrin, Deepest, D11Bhm180e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54141
Homologene: 4718
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Ctsa
Name: cathepsin A
Synonyms: PPCA, Ppgb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19025
HGNC: HGNC:9251
Homologene: 80163
Smn1
Name: survival motor neuron 1
Synonyms: SMN
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20595
Homologene: 292
Stk11
Name: serine/threonine kinase 11
Synonyms: Lkb1, Par-4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20869
Homologene: 393
Pdlim1
Name: PDZ and LIM domain 1 (elfin)
Synonyms: mClim1, CLP36
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54132
HGNC: HGNC:2067
Homologene: 9643
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Ltbr
Name: lymphotoxin B receptor
Synonyms: TNFRrp, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Ltar, TNF-R-III, TNFCR, TNFR2-RP, LTbetaR, Tnfrsf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17000
HGNC: HGNC:6718
Homologene: 1753
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Gabra5
Name: gamma-aminobutyric acid type A receptor subunit alpha 5
Synonyms: A230018I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110886
HGNC: HGNC:4079
Homologene: 20219
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Wdr53
Name: WD repeat domain 53
Synonyms: 1500002B03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68980
Homologene: 15591
Spata6
Name: spermatogenesis associated 6
Synonyms: Hash, 1700062C23Rik, KRP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67946
Homologene: 10410
Cyp2d41-ps
Name: cytochrome P450, family 2, subfamily d, member 41, pseudogene
Synonyms: Gm5062
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 271300
Pla2g2c
Name: phospholipase A2, group IIC
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18781
HGNC: HGNC:9032
Homologene: 7477
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Cstdc1
Name: cystatin domain containing 1
Synonyms: cystatin SC, 8030411F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78609
Homologene: 128710
Gm9873
Name: predicted gene 9873
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: LOC239151, Gm600, SLIP-GC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Atp1a2
Name: ATPase, Na+/K+ transporting, alpha 2 polypeptide
Synonyms: Atpa-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98660
HGNC: HGNC:800
Homologene: 47947
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Igsf9b
Name: immunoglobulin superfamily, member 9B
Synonyms: LOC235086, AI414108
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235086
Homologene: 19472
Or8g32
Name: olfactory receptor family 8 subfamily G member 32
Synonyms: GA_x6K02T2PVTD-33090395-33091330, MOR171-33P, MOR171-49, Olfr951
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258046
VEGA: 9
HGNC: HGNC:8484
Homologene: 71961
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: UGT1.6, Ugt1a6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94284
Homologene: 85959
Fkbpl
Name: FK506 binding protein-like
Synonyms: Ppiase-X, NG7, DIR1, WISp39, WAF-1/CIP1 stabilizing protein 39
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56299
Homologene: 10529
Hook2
Name: hook microtubule tethering protein 2
Synonyms: A630054I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170833
Homologene: 8332
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Gm4952
Name: predicted gene 4952
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240549
Homologene: 72602
Gdf9
Name: growth differentiation factor 9
Synonyms: Gdf-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14566
HGNC: HGNC:4224
Homologene: 3851
Prl7a2
Name: prolactin family 7, subfamily a, member 2
Synonyms: PLP-F, Prlpf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19114
Homologene: 49263
R3hdm4
Name: R3H domain containing 4
Synonyms: C030046I01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109284
VEGA: 10
Homologene: 16343
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: NKT, Oat1, Orctl1, mOat1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Igfals
Name: insulin-like growth factor binding protein, acid labile subunit
Synonyms: ALS, Albs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16005
VEGA: 17
HGNC: HGNC:5468
Homologene: 37987
Hebp2
Name: heme binding protein 2
Synonyms: SOUL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56016
VEGA: 10
Homologene: 8634
Gimap8
Name: GTPase, IMAP family member 8
Synonyms: LOC243374, IAN9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243374
Homologene: 69703
Epn3
Name: epsin 3
Synonyms: 2310022G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71889
Homologene: 56791
Eif1ad16
Name: eukaryotic translation initiation factor 1A domain containing 16
Synonyms: Gm6803
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 627873
VEGA: 12
Pitx1
Name: paired-like homeodomain transcription factor 1
Synonyms: Bft, Ptx1, P-OTX, Potx
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18740
HGNC: HGNC:9004
Homologene: 20584
Gm7358
Name: predicted gene 7358
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 664831
Homologene: 133217
Atad3aos
Name: ATPase family, AAA domain containing 3A, opposite strand
Synonyms: 2610204G22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 70448
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 58,146,508 bp
  • T to G, chromosome 1 at 58,228,925 bp
  • TAAAAAAAAA to TAAAAAAA, chromosome 1 at 88,215,928 bp
  • A to G, chromosome 1 at 132,518,857 bp
  • A to T, chromosome 1 at 132,991,658 bp
  • G to A, chromosome 1 at 162,963,798 bp
  • A to G, chromosome 1 at 172,278,869 bp
  • A to G, chromosome 2 at 37,389,855 bp
  • A to C, chromosome 2 at 76,919,978 bp
  • G to T, chromosome 2 at 148,783,378 bp
  • C to A, chromosome 2 at 164,833,101 bp
  • T to C, chromosome 2 at 169,021,313 bp
  • T to A, chromosome 3 at 86,542,618 bp
  • A to G, chromosome 3 at 100,109,410 bp
  • G to A, chromosome 3 at 108,075,642 bp
  • C to T, chromosome 4 at 44,363,730 bp
  • A to T, chromosome 4 at 56,800,104 bp
  • T to C, chromosome 4 at 83,261,847 bp
  • A to G, chromosome 4 at 111,822,829 bp
  • G to C, chromosome 4 at 117,155,155 bp
  • T to A, chromosome 4 at 138,734,345 bp
  • T to A, chromosome 4 at 155,761,945 bp
  • G to A, chromosome 5 at 77,349,146 bp
  • A to G, chromosome 5 at 121,315,401 bp
  • T to C, chromosome 6 at 48,656,302 bp
  • G to A, chromosome 6 at 125,312,794 bp
  • C to T, chromosome 7 at 57,490,785 bp
  • T to C, chromosome 8 at 85,001,404 bp
  • A to G, chromosome 9 at 15,326,733 bp
  • A to G, chromosome 9 at 27,311,672 bp
  • G to A, chromosome 9 at 32,259,671 bp
  • T to G, chromosome 9 at 39,394,402 bp
  • T to C, chromosome 10 at 18,544,307 bp
  • C to T, chromosome 10 at 79,912,458 bp
  • C to T, chromosome 10 at 80,126,090 bp
  • T to C, chromosome 11 at 8,879,204 bp
  • C to A, chromosome 11 at 21,997,037 bp
  • T to A, chromosome 11 at 53,437,207 bp
  • A to G, chromosome 11 at 54,620,005 bp
  • T to C, chromosome 11 at 69,588,740 bp
  • G to A, chromosome 11 at 78,314,762 bp
  • G to T, chromosome 11 at 94,496,578 bp
  • A to T, chromosome 11 at 98,018,271 bp
  • A to C, chromosome 12 at 88,018,495 bp
  • C to T, chromosome 13 at 27,659,160 bp
  • T to C, chromosome 13 at 55,828,478 bp
  • A to T, chromosome 13 at 100,126,546 bp
  • A to G, chromosome 14 at 65,638,626 bp
  • G to A, chromosome 14 at 67,016,571 bp
  • TCAGCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCA, chromosome 14 at 76,417,267 bp
  • T to A, chromosome 15 at 47,669,203 bp
  • A to G, chromosome 15 at 82,778,064 bp
  • A to G, chromosome 15 at 83,608,695 bp
  • A to G, chromosome 15 at 97,988,873 bp
  • T to A, chromosome 16 at 20,154,162 bp
  • C to T, chromosome 16 at 32,251,934 bp
  • C to T, chromosome 16 at 32,777,672 bp
  • A to G, chromosome 16 at 72,935,777 bp
  • T to A, chromosome 17 at 14,059,092 bp
  • A to G, chromosome 17 at 24,880,093 bp
  • A to T, chromosome 17 at 27,794,046 bp
  • A to T, chromosome 17 at 28,810,562 bp
  • G to A, chromosome 17 at 34,645,329 bp
  • T to C, chromosome 17 at 50,984,632 bp
  • A to G, chromosome 18 at 20,340,954 bp
  • T to C, chromosome 19 at 8,619,422 bp
  • A to T, chromosome 19 at 12,623,629 bp
  • G to A, chromosome 19 at 16,133,426 bp
  • A to T, chromosome 19 at 40,230,549 bp
  • T to A, chromosome 19 at 55,291,160 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5360 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.