Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5314Btlr/Mmmh
Stock Number:
042897-MU
Citation ID:
RRID:MMRRC_042897-MU
Other Names:
R5314 (G1), C57BL/6J-MtgxR5314Btlr
Major Collection:

Strain Information

Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
Zfp930
Name: zinc finger protein 930
Synonyms: zinc finger protein, D10627
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234358
Epc1
Name: enhancer of polycomb homolog 1
Synonyms: A930032N02Rik, 5730566F07Rik, 2400007E14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13831
Homologene: 32627
Snrnp70
Name: small nuclear ribonucleoprotein 70 (U1)
Synonyms: Rnulp70, U1-70, 2700022N21Rik, 3200002N22Rik, Srnp70, Snrp70
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20637
Homologene: 20672
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Tmem87a
Name: transmembrane protein 87A
Synonyms: A930025J12Rik, Elkin1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211499
Homologene: 9165
Satb2
Name: special AT-rich sequence binding protein 2
Synonyms: BAP002
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212712
Homologene: 32249
D6Wsu163e
Name: DNA segment, Chr 6, Wayne State University 163, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28040
HGNC: HGNC:1184
Homologene: 10685
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Enoph1
Name: enolase-phosphatase 1
Synonyms: 2310057D15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67870
Homologene: 5790
Crtc2
Name: CREB regulated transcription coactivator 2
Synonyms: 4632407F12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74343
Homologene: 18765
Treml2
Name: triggering receptor expressed on myeloid cells-like 2
Synonyms: LOC328833
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328833
VEGA: 17
Homologene: 81906
Krt14
Name: keratin 14
Synonyms: epidermolysis bullosa simplex, Dowling-Meara, Koebner, Krt-1.14, K14, Cytokeratin 14, Krt1-14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16664
HGNC: HGNC:6416
Homologene: 110439
Nadk2
Name: NAD kinase 2, mitochondrial
Synonyms: 4933430B08Rik, 1110020G09Rik, Nadkd1, MNADK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68646
Homologene: 14638
Slc7a2
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
Synonyms: Tea, Atrc2, Cat2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11988
Homologene: 20659
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Fbxw18
Name: F-box and WD-40 domain protein 18
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546161
Homologene: 110776
Sema6b
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms: VIb, semaZ, Sema, Seman
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20359
VEGA: 17
Homologene: 8428
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Slc35b2
Name: solute carrier family 35, member B2
Synonyms: 1110003M08Rik, PAPST1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73836
VEGA: 17
Homologene: 24504
Cntn1
Name: contactin 1
Synonyms: CNTN, F3cam, usl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12805
HGNC: HGNC:2171
Homologene: 7274
Atp11b
Name: ATPase, class VI, type 11B
Synonyms: 1110019I14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76295
Homologene: 32919
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268780
Homologene: 65044
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 9130019P20Rik, 4933432B13Rik, A530027J04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108857
Homologene: 87006
Rbm11
Name: RNA binding motif protein 11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224344
HGNC: HGNC:9897
Homologene: 16988
Cfap251
Name: cilia and flagella associated protein 251
Synonyms: 4930415N18Rik, 4933428F06Rik, Wdr66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269701
Homologene: 16964
Or10w1
Name: olfactory receptor family 10 subfamily W member 1
Synonyms: GA_x6K02T2RE5P-3987000-3987950, MOR266-6P, Olfr1490
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258098
Homologene: 79418
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Edar
Name: ectodysplasin-A receptor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13608
HGNC: HGNC:2895
Homologene: 7699
Sntb1
Name: syntrophin, basic 1
Synonyms: beta1-Syntrophin, 59-1 DAP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20649
Homologene: 9618
Or8g32
Name: olfactory receptor family 8 subfamily G member 32
Synonyms: GA_x6K02T2PVTD-33090395-33091330, MOR171-33P, MOR171-49, Olfr951
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258046
VEGA: 9
HGNC: HGNC:8484
Homologene: 71961
Psd4
Name: pleckstrin and Sec7 domain containing 4
Synonyms: SEC7 homolog, EFA6B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215632
Homologene: 8261
Phtf1
Name: putative homeodomain transcription factor 1
Synonyms: Phft
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18685
HGNC: HGNC:8939
Homologene: 4817
Tpsab1
Name: tryptase alpha/beta 1
Synonyms: MMCP-7, Mcp-7, Mcpt7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100503895
Atp8a1
Name: ATPase phospholipid transporting 8A1
Synonyms: Atp3a2, B230107D19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11980
Homologene: 48402
Pde3b
Name: phosphodiesterase 3B, cGMP-inhibited
Synonyms: 9830102A01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18576
HGNC: HGNC:8779
Homologene: 709
Gm4841
Name: predicted gene 4841
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225594
VEGA: 18
Ccdc157
Name: coiled-coil domain containing 157
Synonyms: 4930562D19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216516
Homologene: 72271
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur-6, Glur6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, T1r2, Gpr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83770
Homologene: 75323
Ceacam3
Name: CEA cell adhesion molecule 3
Synonyms: cea12, EG384557, Psg24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384557
HGNC: HGNC:1819
Homologene: 86971
Ccdc136
Name: coiled-coil domain containing 136
Synonyms: 4921511K06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232664
Homologene: 23378
Or8s5
Name: olfactory receptor family 8 subfamily S member 5
Synonyms: GA_x6K02T2NBG7-5395976-5396893, MOR160-4, Olfr284
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 258278
Homologene: 74250
Taar8c
Name: trace amine-associated receptor 8C
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 494546
Homologene: 77586
Sepsecs
Name: Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
Synonyms: SLA, D5Ertd135e, SecS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211006
Homologene: 15031
Csf1r
Name: colony stimulating factor 1 receptor
Synonyms: CSF-1R, M-CSFR, CD115, Fim-2, Fms, Csfmr, Fim2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12978
HGNC: HGNC:2433
Homologene: 3817
Timd2
Name: T cell immunoglobulin and mucin domain containing 2
Synonyms: Tim2, TIM-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171284
Homologene: 82236
Zfp551
Name: zinc finger protein 551
Synonyms: 9630004E07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 619331
Homologene: 64631
Gm7935
Name: predicted pseudogene 7935
Synonyms: Sf3b4_ps
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 666113
VEGA: 15
Gm6505
Name: predicted pseudogene 6505
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 624446
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 56,831,527 bp
  • C to T, chromosome 1 at 84,580,739 bp
  • A to G, chromosome 2 at 24,400,516 bp
  • A to T, chromosome 2 at 52,281,503 bp
  • A to G, chromosome 2 at 120,377,926 bp
  • T to C, chromosome 3 at 28,765,311 bp
  • A to T, chromosome 3 at 35,834,390 bp
  • C to T, chromosome 3 at 90,261,041 bp
  • A to G, chromosome 3 at 95,764,089 bp
  • G to A, chromosome 3 at 103,999,287 bp
  • T to C, chromosome 3 at 121,679,523 bp
  • T to C, chromosome 4 at 55,013,178 bp
  • T to C, chromosome 4 at 129,224,212 bp
  • T to A, chromosome 4 at 139,655,361 bp
  • A to T, chromosome 5 at 52,647,673 bp
  • C to T, chromosome 5 at 67,705,905 bp
  • T to C, chromosome 5 at 100,063,823 bp
  • A to G, chromosome 5 at 123,322,563 bp
  • G to T, chromosome 6 at 29,417,498 bp
  • A to T, chromosome 6 at 126,967,046 bp
  • G to A, chromosome 7 at 12,416,160 bp
  • T to A, chromosome 7 at 16,184,064 bp
  • T to A, chromosome 7 at 17,158,371 bp
  • G to A, chromosome 7 at 45,377,052 bp
  • AAGCAGCAGCAGCAGCAGCAGCAGCA to AAGCAGCAGCAGCAGCAGCAGCA, chromosome 7 at 49,408,692 bp
  • T to C, chromosome 7 at 56,219,786 bp
  • A to T, chromosome 7 at 114,494,537 bp
  • A to G, chromosome 8 at 25,862,458 bp
  • T to C, chromosome 8 at 40,915,030 bp
  • A to G, chromosome 8 at 69,226,721 bp
  • G to A, chromosome 8 at 121,608,598 bp
  • T to C, chromosome 9 at 39,394,489 bp
  • T to A, chromosome 9 at 109,693,178 bp
  • A to T, chromosome 10 at 24,101,348 bp
  • A to T, chromosome 10 at 49,240,792 bp
  • T to C, chromosome 10 at 58,607,360 bp
  • A to T, chromosome 11 at 4,150,078 bp
  • T to C, chromosome 11 at 46,677,260 bp
  • A to T, chromosome 11 at 100,204,700 bp
  • C to T, chromosome 12 at 4,627,960 bp
  • A to G, chromosome 13 at 95,086,853 bp
  • A to G, chromosome 15 at 7,304,012 bp
  • A to C, chromosome 15 at 9,108,313 bp
  • C to G, chromosome 15 at 55,642,795 bp
  • C to A, chromosome 15 at 74,080,349 bp
  • T to A, chromosome 15 at 85,070,865 bp
  • A to G, chromosome 15 at 92,295,011 bp
  • G to A, chromosome 15 at 98,340,365 bp
  • T to C, chromosome 16 at 75,596,586 bp
  • G to A, chromosome 17 at 25,343,398 bp
  • T to C, chromosome 17 at 45,566,498 bp
  • T to A, chromosome 17 at 48,300,573 bp
  • G to A, chromosome 17 at 56,128,413 bp
  • A to G, chromosome 18 at 6,462,969 bp
  • A to T, chromosome 18 at 36,561,058 bp
  • A to G, chromosome 18 at 60,270,292 bp
  • T to A, chromosome 18 at 61,129,724 bp
  • T to C, chromosome 19 at 13,655,266 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5314 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042897-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.