Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5277Btlr/Mmmh
Stock Number:
042864-MU
Citation ID:
RRID:MMRRC_042864-MU
Other Names:
R5277 (G1), C57BL/6J-MtgxR5277Btlr
Major Collection:

Strain Information

Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Mc3r
Name: melanocortin 3 receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17201
HGNC: HGNC:6931
Homologene: 7412
Neurog3
Name: neurogenin 3
Synonyms: ngn3, Atoh5, bHLHa7, Math4B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11925
VEGA: 10
Homologene: 40692
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Wdr70
Name: WD repeat domain 70
Synonyms: 4833422F06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545085
VEGA: 15
Homologene: 9972
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Ric8b
Name: RIC8 guanine nucleotide exchange factor B
Synonyms: Ric-8, Ric-8b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237422
VEGA: 10
Homologene: 23080
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Mettl13
Name: methyltransferase 13, eEF1A lysine and N-terminal methyltransferase
Synonyms: 5630401D24Rik, Eef1aknmt
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71449
Homologene: 32285
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NMDAR2C, NR2C, GluRepsilon3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Sema6a
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms: VIa, sema, Sema6A-1, Semaq, A730020P05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20358
Homologene: 32426
Prmt5
Name: protein arginine N-methyltransferase 5
Synonyms: Jbp1, Jak-binding protein 1, Skb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27374
Homologene: 4454
Dcaf6
Name: DDB1 and CUL4 associated factor 6
Synonyms: PC326, 1200006M05Rik, Iqwd1, NRIP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74106
Homologene: 10199
Fam13b
Name: family with sequence similarity 13, member B
Synonyms: 2610024E20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225358
VEGA: 18
HGNC: HGNC:1335
Homologene: 9585
Bhmt
Name: betaine-homocysteine methyltransferase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12116
HGNC: HGNC:1047
Homologene: 1295
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Urod
Name: uroporphyrinogen decarboxylase
Synonyms: Uro-d
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22275
Homologene: 320
Vmn1r37
Name: vomeronasal 1 receptor 37
Synonyms: V1rc10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171183
Homologene: 110800
Camk2d
Name: calcium/calmodulin-dependent protein kinase II, delta
Synonyms: CaMK II, 2810011D23Rik, 8030469K03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 108058
HGNC: HGNC:1462
Homologene: 55561
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Vmn2r102
Name: vomeronasal 2, receptor 102
Synonyms: EG224572
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224572
Homologene: 115024
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51938
Homologene: 12149
Vmn2r75
Name: vomeronasal 2, receptor 75
Synonyms: EG546981
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546981
Homologene: 115466
Fyb2
Name: FYN binding protein 2
Synonyms: 1700024P16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242594
Homologene: 52981
Dclre1a
Name: DNA cross-link repair 1A
Synonyms: mSNM1, SNM1, 2810043H12Rik, SMN1a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 55947
Homologene: 8920
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Vwde
Name: von Willebrand factor D and EGF domains
Synonyms: LOC232585
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232585
Homologene: 35456
Ablim1
Name: actin-binding LIM protein 1
Synonyms: Limab1, abLIM-S, abLIM-M, abLIM-L, 4833406P10Rik, 2610209L21Rik, 9330196J19Rik, 2210411C18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226251
HGNC: HGNC:78
Homologene: 40994
Ppfibp1
Name: PTPRF interacting protein, binding protein 1 (liprin beta 1)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67533
HGNC: HGNC:9249
Homologene: 2685
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, SRRP129, CASP11, SIP1, 2610510E10Rik, Sfrs2ip, Srsf2ip
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
Tmem63c
Name: transmembrane protein 63c
Synonyms: 9330187M14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217733
Homologene: 33129
Tmbim7
Name: transmembrane BAX inhibitor motif containing 7
Synonyms: 4930500J03Rik, 4930403J02Rik, Lfg5, Tmbim1b, 4930511M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75010
Homologene: 81927
Gtpbp3
Name: GTP binding protein 3
Synonyms: Gtpbp3, 2410009F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70359
Homologene: 6600
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77629
Homologene: 18172
Kif4-ps
Name: kinesin family member 4, pseudogene
Synonyms: Kif4b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 74947
Dusp10
Name: dual specificity phosphatase 10
Synonyms: MKP-5, 2610306G15Rik, MKP5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63953
HGNC: HGNC:3065
Homologene: 5215
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: Nalp-epsilon, Nalp4e, 4930406H16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446099
Homologene: 75315
Bco1
Name: beta-carotene oxygenase 1
Synonyms: beta-CD, Bcdo, Bcdo1, betaCMOOX, Cmoi, Bcmo1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 63857
Homologene: 41172
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Tmem69
Name: transmembrane protein 69
Synonyms: A630048M13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230657
Homologene: 9531
Ppp2r2b
Name: protein phosphatase 2, regulatory subunit B, beta
Synonyms: 6330404L05Rik, PP2A-PR55B, PR55-BETA, SCA12, 2900026H06Rik, E130009M08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72930
HGNC: HGNC:9305
Homologene: 55833
Or52d13
Name: olfactory receptor family 52 subfamily D member 13
Synonyms: GA_x6K02T2PBJ9-6182881-6181898, MOR33-3P, EG546989, Gm15121, Olfr607
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546989
Homologene: 78211
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Gm6180
Name: predicted pseudogene 6180
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 620772
Rslcan18
Name: regulator of sex-limitation candidate 18
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432770
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 83,276,164 bp
  • A to T, chromosome 1 at 126,026,540 bp
  • A to T, chromosome 1 at 162,537,297 bp
  • A to G, chromosome 1 at 165,424,346 bp
  • A to G, chromosome 1 at 184,037,007 bp
  • T to C, chromosome 2 at 22,994,648 bp
  • T to C, chromosome 2 at 172,249,787 bp
  • G to A, chromosome 2 at 177,832,984 bp
  • C to T, chromosome 3 at 33,813,155 bp
  • T to C, chromosome 3 at 126,684,741 bp
  • G to A, chromosome 4 at 105,015,679 bp
  • A to G, chromosome 4 at 116,553,261 bp
  • A to T, chromosome 4 at 116,990,285 bp
  • G to A, chromosome 5 at 3,673,192 bp
  • C to T, chromosome 5 at 124,828,137 bp
  • T to C, chromosome 6 at 13,186,996 bp
  • A to T, chromosome 6 at 66,731,476 bp
  • A to G, chromosome 6 at 147,000,951 bp
  • T to C, chromosome 7 at 23,321,438 bp
  • A to G, chromosome 7 at 46,246,621 bp
  • A to C, chromosome 7 at 86,166,292 bp
  • G to A, chromosome 7 at 100,390,102 bp
  • A to T, chromosome 7 at 103,460,941 bp
  • A to G, chromosome 8 at 42,247,140 bp
  • G to A, chromosome 8 at 55,991,207 bp
  • A to G, chromosome 8 at 71,492,710 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • T to A, chromosome 8 at 117,117,389 bp
  • T to A, chromosome 10 at 62,133,853 bp
  • G to A, chromosome 10 at 84,947,652 bp
  • C to A, chromosome 11 at 60,477,114 bp
  • A to G, chromosome 11 at 67,252,354 bp
  • A to G, chromosome 11 at 115,253,813 bp
  • A to G, chromosome 11 at 119,822,956 bp
  • T to A, chromosome 12 at 87,057,757 bp
  • A to T, chromosome 12 at 101,145,927 bp
  • T to G, chromosome 13 at 67,098,434 bp
  • A to T, chromosome 13 at 93,624,885 bp
  • A to T, chromosome 14 at 54,509,942 bp
  • A to G, chromosome 14 at 54,956,562 bp
  • C to T, chromosome 15 at 7,976,984 bp
  • A to G, chromosome 15 at 68,165,909 bp
  • T to C, chromosome 15 at 76,881,203 bp
  • A to T, chromosome 15 at 96,419,226 bp
  • C to T, chromosome 16 at 11,399,824 bp
  • A to G, chromosome 17 at 19,694,131 bp
  • G to A, chromosome 18 at 34,462,190 bp
  • G to T, chromosome 18 at 42,741,142 bp
  • A to T, chromosome 18 at 47,276,544 bp
  • C to T, chromosome 19 at 56,544,732 bp
  • T to C, chromosome 19 at 57,155,261 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5277 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042864-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.