Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5464Btlr/Mmmh
Stock Number:
042850-MU
Citation ID:
RRID:MMRRC_042850-MU
Other Names:
R5464 (G1), C57BL/6J-MtgxR5464Btlr
Major Collection:

Strain Information

Trim32
Name: tripartite motif-containing 32
Synonyms: 3f3, 1810045E12Rik, Zfp117, BBS11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69807
Homologene: 36327
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Ift52
Name: intraflagellar transport 52
Synonyms: NGD5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245866
Homologene: 9335
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Gpatch4
Name: G patch domain containing 4
Synonyms: 2610029K21Rik, Gpatc4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66614
Homologene: 9203
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217995
VEGA: 13
Homologene: 34562
Sf3a3
Name: splicing factor 3a, subunit 3
Synonyms: 4930512K19Rik, 60kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75062
Homologene: 4949
Crot
Name: carnitine O-octanoyltransferase
Synonyms: 1200003H03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74114
HGNC: HGNC:2366
Homologene: 10899
Cttn
Name: cortactin
Synonyms: Ems1, 1110020L01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13043
HGNC: HGNC:3338
Homologene: 3834
Slc3a2
Name: solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
Synonyms: Mgp-2hc, Ly-m10, Ly-10, Mdu1, 4F2HC, Cd98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17254
Homologene: 1795
Dnaja1
Name: DnaJ heat shock protein family (Hsp40) member A1
Synonyms: Hsj2, Nedd7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15502
HGNC: HGNC:5229
Homologene: 55588
Zfp473
Name: zinc finger protein 473
Synonyms: D030014N22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243963
Homologene: 18698
L1td1
Name: LINE-1 type transposase domain containing 1
Synonyms: ECAT11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381591
Homologene: 135709
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20850
Homologene: 20680
Alox12e
Name: arachidonate lipoxygenase, epidermal
Synonyms: 8-LOX, e-LOX1, Alox12-ps1, Aloxe, Alox12-ps2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11685
Homologene: 105868
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Acsl1
Name: acyl-CoA synthetase long-chain family member 1
Synonyms: Acas1, Facl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14081
HGNC: HGNC:3569
Homologene: 37561
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Mroh8
Name: maestro heat-like repeat family member 8
Synonyms: 4922505G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 629499
Homologene: 51864
Adamts16
Name: ADAM metallopeptidase with thrombospondin type 1 motif 16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 271127
Homologene: 15146
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
4930562C15Rik
Name: RIKEN cDNA 4930562C15 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78809
Homologene: 53527
Flg2
Name: filaggrin family member 2
Synonyms: EG229574
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229574
Homologene: 134146
Rsph4a
Name: radial spoke head 4 homolog A (Chlamydomonas)
Synonyms: Rshl3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212892
Homologene: 71779
Serpina3i
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3I
Synonyms: 2B2, antitrypsin, alpha-1 antiproteinase, Gm6930
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 628900
HGNC: HGNC:16
Homologene: 115927
Ppp1r36
Name: protein phosphatase 1, regulatory subunit 36
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 210762
VEGA: 12
Homologene: 52094
Prss36
Name: serine protease 36
Synonyms: polyserase-2, C330007D15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77613
Homologene: 18303
Sp100
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20684
Homologene: 86761
Snx19
Name: sorting nexin 19
Synonyms: 3526401K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102607
VEGA: 9
Homologene: 8846
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Or52a24
Name: olfactory receptor family 52 subfamily A member 24
Synonyms: GA_x6K02T2PBJ9-6457667-6458617, MOR22-4P, MOR22-1, MOR22-4P, Olfr1526-ps1, Olfr628
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259159
Homologene: 8420
Or51a39
Name: olfactory receptor family 51 subfamily A member 39
Synonyms: MTPCR33, MOR11-2, GA_x6K02T2PBJ9-5431102-5430146, Olfr33
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18332
Homologene: 81534
Or4ac1-ps1
Name: olfactory receptor family 4 subfamily AC member 1, pseudogene 1
Synonyms: GA_x6K02T2Q125-50027818-50027495, Olfr1187-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 404484
VEGA: 2
Serpinb3c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms: 1110001H02Rik, 1110013A16Rik, ovalbumin, Serpinb4, Scca2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381286
Homologene: 131278
Smco1
Name: single-pass membrane protein with coiled-coil domains 1
Synonyms: 2310010M20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69576
Homologene: 18842
Wipf3
Name: WAS/WASL interacting protein family, member 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330319
Homologene: 113391
Or51f5
Name: olfactory receptor family 51 subfamily F member 5
Synonyms: GA_x6K02T2PBJ9-5491151-5492095, MOR14-2, Olfr561
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259096
Homologene: 133029
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Or6x1
Name: olfactory receptor family 6 subfamily X member 1
Synonyms: GA_x6K02T2PVTD-33886895-33887833, MOR104-3, Olfr986
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258608
VEGA: 9
Homologene: 105185
Naa12
Name: N(alpha)-acetyltransferase 12, NatA catalytic subunit
Synonyms: Gm16286
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 117903916
Selenbp1
Name: selenium binding protein 1
Synonyms: Lp56, Lpsb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20341
Homologene: 2930
Sgcg
Name: sarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonyms: gamma-SG, 5430420E18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 24053
Homologene: 194
Or51a43
Name: olfactory receptor family 51 subfamily A member 43
Synonyms: GA_x6K02T2PBJ9-6803062-6802118, MOR13-1, Olfr644
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259125
Homologene: 17491
Or51a25
Name: olfactory receptor family 51 subfamily A member 25
Synonyms: GA_x6K02T2PBJ9-5441154-5440198, MOR11-1, Olfr559
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259116
Homologene: 74124
Mrpl19
Name: mitochondrial ribosomal protein L19
Synonyms: MRP-L15, D6Ertd157e, Rpml15, RLX1, 9030416F12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56284
Homologene: 8851
Zgpat
Name: zinc finger, CCCH-type with G patch domain
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229007
Homologene: 41874
Or5ak23
Name: olfactory receptor family 5 subfamily AK member 23
Synonyms: GA_x6K02T2Q125-46891524-46890580, MOR203-2, Olfr993
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258427
Homologene: 79352
Mcub
Name: modifier of curly bare
Synonyms: 9030408N13Rik, Ccdc109b
Type: Gene
Species: Mouse
Chromosome: 3
Atp13a2
Name: ATPase type 13A2
Synonyms: 1110012E06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74772
Homologene: 56940
Or10d4
Name: olfactory receptor family 10 subfamily D member 4
Synonyms: GA_x6K02T2PVTD-33365879-33366814, MOR224-7P, MOR224-13, Olfr963
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258087
VEGA: 9
Homologene: 105216
Mettl15
Name: methyltransferase like 15
Synonyms: 0610027B03Rik, Mett5d1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76894
Homologene: 12661
Acyp2
Name: acylphosphatase 2, muscle type
Synonyms: 2310004B09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 75572
HGNC: HGNC:180
Homologene: 41776
Psmg4
Name: proteasome (prosome, macropain) assembly chaperone 4
Synonyms: 2310047M15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69666
Homologene: 19154
Gm7546
Name: predicted gene 7546
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 85,694,223 bp
  • A to T, chromosome 1 at 107,271,704 bp
  • C to T, chromosome 2 at 65,701,756 bp
  • AAGTCTGGAGTC to AAGTC, chromosome 2 at 85,414,713 bp
  • T to C, chromosome 2 at 88,540,255 bp
  • C to T, chromosome 2 at 109,191,622 bp
  • T to A, chromosome 2 at 157,221,230 bp
  • T to C, chromosome 2 at 163,029,815 bp
  • T to C, chromosome 2 at 181,380,213 bp
  • T to C, chromosome 3 at 88,054,755 bp
  • C to A, chromosome 3 at 93,201,970 bp
  • A to G, chromosome 3 at 94,944,416 bp
  • T to C, chromosome 3 at 129,915,716 bp
  • T to A, chromosome 4 at 40,724,133 bp
  • A to G, chromosome 4 at 65,614,388 bp
  • TGGGGGAGGAGGAAGAGGACTCTGGGGAGGAGGAGGAGGAGGAGG to TGG, chromosome 4 at 98,736,750 bp
  • T to C, chromosome 4 at 124,728,240 bp
  • C to T, chromosome 4 at 131,772,557 bp
  • T to A, chromosome 4 at 141,006,070 bp
  • T to A, chromosome 4 at 154,346,144 bp
  • T to G, chromosome 5 at 8,983,690 bp
  • T to C, chromosome 5 at 73,608,279 bp
  • T to C, chromosome 6 at 54,485,323 bp
  • A to G, chromosome 6 at 81,962,011 bp
  • C to T, chromosome 6 at 137,527,475 bp
  • T to C, chromosome 7 at 44,732,638 bp
  • T to C, chromosome 7 at 65,635,640 bp
  • T to C, chromosome 7 at 102,713,682 bp
  • A to G, chromosome 7 at 102,723,917 bp
  • A to G, chromosome 7 at 102,775,433 bp
  • T to A, chromosome 7 at 103,732,189 bp
  • C to A, chromosome 7 at 104,068,467 bp
  • A to T, chromosome 7 at 127,934,233 bp
  • G to T, chromosome 7 at 144,436,939 bp
  • T to A, chromosome 8 at 46,505,738 bp
  • A to G, chromosome 9 at 30,427,973 bp
  • A to T, chromosome 9 at 39,669,770 bp
  • T to C, chromosome 9 at 40,187,784 bp
  • T to C, chromosome 10 at 33,909,341 bp
  • C to T, chromosome 11 at 30,506,354 bp
  • T to C, chromosome 11 at 70,317,679 bp
  • C to T, chromosome 11 at 100,876,735 bp
  • A to T, chromosome 12 at 76,428,078 bp
  • G to A, chromosome 12 at 104,268,492 bp
  • T to A, chromosome 13 at 12,433,643 bp
  • A to T, chromosome 13 at 34,178,064 bp
  • T to A, chromosome 13 at 70,761,749 bp
  • A to G, chromosome 14 at 61,236,855 bp
  • T to A, chromosome 15 at 90,993,855 bp
  • G to A, chromosome 16 at 4,864,363 bp
  • T to A, chromosome 16 at 32,273,876 bp
  • A to G, chromosome 18 at 63,145,105 bp
  • C to T, chromosome 18 at 80,211,923 bp
  • T to C, chromosome 19 at 8,713,644 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5464 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042850-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.