Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5056Btlr/Mmmh
Stock Number:
042646-MU
Citation ID:
RRID:MMRRC_042646-MU
Other Names:
R5056 (G1), C57BL/6J-MtgxR5056Btlr
Major Collection:

Strain Information

Adora2a
Name: adenosine A2a receptor
Synonyms: A2aR, A2AAR, AA2AR, A2a, Rs, ARA2A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11540
VEGA: 10
HGNC: HGNC:263
Homologene: 20166
Trib2
Name: tribbles pseudokinase 2
Synonyms: TRB2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217410
Homologene: 41445
Sfrp1
Name: secreted frizzled-related protein 1
Synonyms: sFRP-1, 2210415K03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20377
Homologene: 2266
Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54445
Homologene: 41325
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60611
Homologene: 10187
Wfs1
Name: wolframin ER transmembrane glycoprotein
Synonyms: wolframin, Wolfram syndrome 1 homolog (human)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22393
Homologene: 4380
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Lrch4
Name: leucine-rich repeats and calponin homology (CH) domain containing 4
Synonyms: 2900069C24Rik, LRRN4, LRN, 2810008P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231798
HGNC: HGNC:6691
Homologene: 20532
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Rnf14
Name: ring finger protein 14
Synonyms: Triad2, 2310075C09Rik, 2610005D23Rik, D18Ertd188e, D7Bwg0165e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56736
VEGA: 18
Homologene: 129170
Med13
Name: mediator complex subunit 13
Synonyms: Trap240, 1110067M05Rik, Thrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327987
Homologene: 21067
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Dmkn
Name: dermokine
Synonyms: cI-36, sk30, sk89, Dmkn, dermokine, 1110014F24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73712
Homologene: 136295
Hspa9
Name: heat shock protein 9
Synonyms: mortalin, Hsp74a, Hsp74, Hsc74, PBP74, GRP75, mthsp70, mot-2, Hspa9a, C3H-specific antigen, CSA
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15526
HGNC: HGNC:5244
Homologene: 39452
Ppp3ca
Name: protein phosphatase 3, catalytic subunit, alpha isoform
Synonyms: PP2B alpha 1, PP2BA alpha, CnA, Caln, Calna, 2900074D19Rik, CN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19055
HGNC: HGNC:9314
Homologene: 55497
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Prss14, Epithin, MT-SP1, matriptase, Tmprss14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19143
Homologene: 7906
Mettl16
Name: methyltransferase 16, N6-methyladenosine
Synonyms: 2610100D03Rik, A830095F14Rik, 2810013M15Rik, Mett10d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67493
Homologene: 34653
Sil1
Name: SIL1 nucleotide exchange factor
Synonyms: 1810057E01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 81500
VEGA: 18
Homologene: 32544
Agap3
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Synonyms: MRIP-1, Crag, Centg3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213990
Homologene: 23742
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Wif1
Name: Wnt inhibitory factor 1
Synonyms: WIF-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 24117
Homologene: 31430
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Cmtr1
Name: cap methyltransferase 1
Synonyms: 1300018I05Rik, Ftsjd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74157
Homologene: 9003
Zfp808
Name: zinc finger protein 808
Synonyms: Gm7036
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 630579
Homologene: 134631
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Ogfrl1
Name: opioid growth factor receptor-like 1
Synonyms: 2210417C17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70155
Homologene: 11595
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668940
Homologene: 66117
Brd10
Name: bromodomain containing 10
Synonyms: Gm9832, 9930021J03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240613
Homologene: 19046
Map6
Name: microtubule-associated protein 6
Synonyms: F-STOP, STOP, 2810411E12Rik, Mtap6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17760
HGNC: HGNC:6868
Homologene: 7850
Mbd6
Name: methyl-CpG binding domain protein 6
Synonyms: D10Wsu93e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110962
Homologene: 14171
Ccdc39
Name: coiled-coil domain containing 39
Synonyms: 4921507O14Rik, D3Ertd789e, b2b1735Clo, b2b1304Clo, b2b2025.1Clo, prh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 51938
Homologene: 12149
Tbc1d9
Name: TBC1 domain family, member 9
Synonyms: C76116, 4933431N12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71310
Homologene: 57079
Trnau1ap
Name: tRNA selenocysteine 1 associated protein 1
Synonyms: 1110007F05Rik, SECp43, Trspap1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71787
Homologene: 49509
Or5m13
Name: olfactory receptor family 5 subfamily M member 13
Synonyms: GA_x6K02T2Q125-47397266-47398205, MOR196-6_p, MOR196-5P, Olfr1025
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258083
Bbs10
Name: Bardet-Biedl syndrome 10
Synonyms: 1300007O09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71769
VEGA: 10
Homologene: 49781
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Dsbc1, Rcr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Cenpb
Name: centromere protein B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12616
HGNC: HGNC:1852
Homologene: 1370
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Aldh18a1
Name: aldehyde dehydrogenase 18 family, member A1
Synonyms: 2810433K04Rik, Pycs
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56454
HGNC: HGNC:9722
Homologene: 2142
Apc2
Name: APC regulator of WNT signaling pathway 2
Synonyms: APCL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23805
Homologene: 4299
Tmem67
Name: transmembrane protein 67
Synonyms: 5330408M12Rik, b2b1291.1Clo, b2b1163.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329795
Homologene: 71886
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: 4732473B16Rik, Fam46b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100342
Homologene: 24928
Kcna7
Name: potassium voltage-gated channel, shaker-related subfamily, member 7
Synonyms: Kv1.7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16495
HGNC: HGNC:6226
Homologene: 7791
Chil6
Name: chitinase-like 6
Synonyms: BYm, BC051070
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229688
Homologene: 77638
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930438C08Rik, 4930589M24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
Or9m1
Name: olfactory receptor family 9 subfamily M member 1
Synonyms: GA_x6K02T2Q125-49403456-49402524, MOR173-2, Olfr1154
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258641
Homologene: 74192
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd, r, Pdeb, rd10, rd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, potassium channel Kv4.3L, Kv4.3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Klhdc8b
Name: kelch domain containing 8B
Synonyms: 4931406O17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78267
Homologene: 45463
Pafah1b3
Name: platelet-activating factor acetylhydrolase, isoform 1b, subunit 3
Synonyms: mus[g], Pafahg, PAF-AH alpha1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18476
HGNC: HGNC:8576
Homologene: 1933
Asic2
Name: acid-sensing ion channel 2
Synonyms: Mdeg, BNaC1a, BNC1, Accn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11418
HGNC: HGNC:99
Homologene: 137202
Or52l1
Name: olfactory receptor family 52 subfamily L member 1
Synonyms: GA_x6K02T2PBJ9-7810071-7809121, MOR37-1, Olfr685
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258160
Homologene: 66455
Sgms1
Name: sphingomyelin synthase 1
Synonyms: SMS1, 9530058O11Rik, SMS1gamma, SMS1beta, SMS1alpha2, SMS1alpha1, Tmem23
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 208449
Homologene: 27040
1700030J22Rik
Name: RIKEN cDNA 1700030J22 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69528
Homologene: 51842
Zpbp
Name: zona pellucida binding protein
Synonyms: Sp38, 4930486K01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53604
Homologene: 5092
Or8k36
Name: olfactory receptor family 8 subfamily K member 36
Synonyms: GA_x6K02T2Q125-48092599-48091658, MOR191-3, Or8k36-ps1, Olfr1083-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404326
Vmn2r48
Name: vomeronasal 2, receptor 48
Synonyms: EG625580
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 625580
Homologene: 113703
Gm14176
Name: predicted gene 14176
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100043681
4930483K19Rik
Name: RIKEN cDNA 4930483K19 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 74953
Mir5101
Name: microRNA 5101
Synonyms: mmu-mir-5101
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100628610
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 23,379,049 bp
  • G to T, chromosome 1 at 104,953,997 bp
  • A to T, chromosome 1 at 134,834,392 bp
  • G to T, chromosome 1 at 134,955,733 bp
  • A to T, chromosome 1 at 164,192,032 bp
  • T to A, chromosome 2 at 30,304,131 bp
  • T to A, chromosome 2 at 85,918,136 bp
  • T to A, chromosome 2 at 86,607,020 bp
  • T to C, chromosome 2 at 87,903,571 bp
  • C to T, chromosome 2 at 131,178,171 bp
  • G to C, chromosome 2 at 155,632,373 bp
  • T to C, chromosome 2 at 157,901,947 bp
  • C to T, chromosome 3 at 33,813,155 bp
  • T to A, chromosome 3 at 105,666,928 bp
  • T to A, chromosome 3 at 106,394,343 bp
  • C to T, chromosome 3 at 136,881,532 bp
  • T to C, chromosome 4 at 12,070,471 bp
  • T to C, chromosome 4 at 132,327,171 bp
  • C to T, chromosome 4 at 133,480,438 bp
  • T to C, chromosome 5 at 24,477,862 bp
  • T to C, chromosome 5 at 36,975,587 bp
  • T to C, chromosome 5 at 93,638,925 bp
  • A to T, chromosome 5 at 108,423,491 bp
  • C to G, chromosome 5 at 137,636,851 bp
  • A to G, chromosome 6 at 111,080,443 bp
  • A to G, chromosome 6 at 122,833,874 bp
  • T to A, chromosome 7 at 9,942,324 bp
  • T to C, chromosome 7 at 24,228,737 bp
  • C to T, chromosome 7 at 25,295,339 bp
  • T to C, chromosome 7 at 30,764,104 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 45,308,630 bp
  • G to A, chromosome 7 at 45,406,591 bp
  • T to C, chromosome 7 at 99,336,652 bp
  • T to A, chromosome 7 at 105,180,572 bp
  • A to G, chromosome 7 at 120,020,946 bp
  • T to A, chromosome 8 at 23,417,404 bp
  • T to C, chromosome 8 at 83,269,206 bp
  • T to C, chromosome 8 at 95,741,008 bp
  • T to A, chromosome 8 at 116,971,682 bp
  • A to G, chromosome 9 at 31,097,551 bp
  • T to C, chromosome 9 at 37,404,806 bp
  • ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC to ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC, chromosome 9 at 108,448,985 bp
  • A to T, chromosome 10 at 53,674,574 bp
  • T to A, chromosome 10 at 75,326,158 bp
  • T to G, chromosome 10 at 76,552,926 bp
  • T to C, chromosome 10 at 80,301,314 bp
  • C to T, chromosome 10 at 111,300,540 bp
  • A to T, chromosome 10 at 121,099,779 bp
  • C to T, chromosome 10 at 127,286,441 bp
  • T to C, chromosome 11 at 11,459,734 bp
  • C to T, chromosome 11 at 74,661,946 bp
  • T to A, chromosome 11 at 74,816,940 bp
  • T to A, chromosome 11 at 80,971,603 bp
  • A to G, chromosome 11 at 85,026,795 bp
  • A to T, chromosome 11 at 86,328,565 bp
  • C to A, chromosome 12 at 15,793,794 bp
  • A to G, chromosome 12 at 75,909,131 bp
  • T to A, chromosome 13 at 62,172,630 bp
  • A to T, chromosome 15 at 36,050,245 bp
  • T to C, chromosome 17 at 15,562,417 bp
  • A to G, chromosome 17 at 29,690,328 bp
  • A to T, chromosome 18 at 20,050,142 bp
  • A to G, chromosome 18 at 34,938,681 bp
  • T to C, chromosome 18 at 35,269,702 bp
  • C to T, chromosome 18 at 38,308,388 bp
  • T to C, chromosome 18 at 49,870,923 bp
  • A to G, chromosome 19 at 3,942,762 bp
  • A to T, chromosome 19 at 29,717,359 bp
  • A to G, chromosome 19 at 32,159,687 bp
  • G to A, chromosome 19 at 40,574,262 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5056 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042646-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.