Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR4080Btlr/Mmmh
Stock Number:
040856-MU
Citation ID:
RRID:MMRRC_040856-MU
Other Names:
R4080 (G1), C57BL/6J-MtgxR4080Btlr
Major Collection:

Strain Information

Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Unc93b1
Name: unc-93 homolog B1, TLR signaling regulator
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54445
Homologene: 41325
Prss12
Name: serine protease 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19142
HGNC: HGNC:9477
Homologene: 7490
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Ptpa
Name: protein phosphatase 2 protein activator
Synonyms: 2610042B21Rik, Ppp2r4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110854
HGNC: HGNC:9308
Homologene: 6149
Lrrc41
Name: leucine rich repeat containing 41
Synonyms: D730026A16Rik, MUF1, D630045E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230654
Homologene: 4645
Nek6
Name: NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms: 1300007C09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59126
HGNC: HGNC:7749
Homologene: 49379
Trappc9
Name: trafficking protein particle complex 9
Synonyms: 4632408O18Rik, 2900005P22Rik, Nibp, TRS130, 1810044A24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Zfr
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22763
Homologene: 8009
Scfd1
Name: Sec1 family domain containing 1
Synonyms: STXBP1L2, RA410, 3110021P21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76983
VEGA: 12
Homologene: 5650
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64706
Homologene: 11224
Chrna2
Name: cholinergic receptor nicotinic alpha 2 subunit
Synonyms: Acra-2, Acra2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110902
HGNC: HGNC:1956
Homologene: 20193
Unc5a
Name: unc-5 netrin receptor A
Synonyms: Unc5h1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107448
Homologene: 41474
Cttn
Name: cortactin
Synonyms: Ems1, 1110020L01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13043
HGNC: HGNC:3338
Homologene: 3834
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Arhgef1
Name: Rho guanine nucleotide exchange factor 1
Synonyms: Lsc, Lbcl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16801
HGNC: HGNC:681
Homologene: 3454
Rex2
Name: reduced expression 2
Synonyms: Gm13138
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100043034
Homologene: 133076
Adgrf3
Name: adhesion G protein-coupled receptor F3
Synonyms: LOC381628, PGR23, Gpr113
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381628
Homologene: 17826
Nktr
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Eif2a
Name: eukaryotic translation initiation factor 2A
Synonyms: D3Ertd194e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229317
HGNC: HGNC:3254
Homologene: 5969
Cdk12
Name: cyclin dependent kinase 12
Synonyms: 1810022J16Rik, Crk7, D11Ertd752e, Crkrs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69131
Homologene: 128632
Reck
Name: reversion-inducing-cysteine-rich protein with kazal motifs
Synonyms: St15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53614
Homologene: 9622
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Zfp667
Name: zinc finger protein 667
Synonyms: A830025F02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384763
Homologene: 23343
Myo16
Name: myosin XVI
Synonyms: C230040D10Rik, Nyap3, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Hgsnat
Name: heparan-alpha-glucosaminide N-acetyltransferase
Synonyms: 9430010M12Rik, D8Ertd354e, Tmem76
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52120
Homologene: 15586
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Zfp469
Name: zinc finger protein 469
Synonyms: LOC195209, Gm22
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 195209
Homologene: 18937
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Sybu
Name: syntabulin (syntaxin-interacting)
Synonyms: A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
C7
Name: complement component 7
Synonyms: LOC383055
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109828
VEGA: 15
HGNC: HGNC:1346
Homologene: 489
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Clec2g
Name: C-type lectin domain family 2, member g
Synonyms: 4632413B12Rik, Ocilrp1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70809
Homologene: 136309
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215456
Homologene: 19037
Lrrc19
Name: leucine rich repeat containing 19
Synonyms: 9130022A01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100061
Homologene: 36410
Frmpd1
Name: FERM and PDZ domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666060
Homologene: 8939
Prorp
Name: protein only RNase P catalytic subunit
Synonyms: 1110008L16Rik, Mrpp3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66132
Homologene: 45935
L3hypdh
Name: L-3-hydroxyproline dehydratase (trans-)
Synonyms: 2810055F11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67217
Homologene: 12100
Aass
Name: aminoadipate-semialdehyde synthase
Synonyms: LOR/SDH, Lorsdh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30956
Homologene: 4212
Dcbld2
Name: discoidin, CUB and LCCL domain containing 2
Synonyms: 1700055P21Rik, Esdn, CLCP1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 73379
Homologene: 12499
Spty2d1
Name: SPT2 chromatin protein domain containing 1
Synonyms: 5830435K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101685
Homologene: 45499
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Pabpc2
Name: poly(A) binding protein, cytoplasmic 2
Synonyms: Pabp2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18459
Homologene: 56509
Or5h22
Name: olfactory receptor family 5 subfamily H member 22
Synonyms: GA_x54KRFPKG5P-55303207-55302284, MOR183-4, Olfr190
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258392
Homologene: 131129
Aim2
Name: absent in melanoma 2
Synonyms: LOC383619, Ifi210
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 383619
HGNC: HGNC:357
Homologene: 83226
Ccdc158
Name: coiled-coil domain containing 158
Synonyms: 4932413O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320696
Homologene: 18560
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Cyp2c40
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13099
Homologene: 74936
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 636808
Homologene: 43974
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Txk
Name: TXK tyrosine kinase
Synonyms: Rlk, Btkl, PTK4, A130089B16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22165
Homologene: 2497
Plekhg3
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 3
Synonyms: MGC40768
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 263406
VEGA: 12
Homologene: 77478
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
C230029F24Rik
Name: RIKEN cDNA C230029F24 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 442837
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Reep6
Name: receptor accessory protein 6
Synonyms: Dp1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70335
Homologene: 133833
Rtl6
Name: retrotransposon Gag like 6
Synonyms: Mart6, Mar6, Ldoc1l
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223732
VEGA: 15
Homologene: 18594
Or1ad1
Name: olfactory receptor family 1 subfamily AD member 1
Synonyms: GA_x6K02T2QP88-4453480-4452557, MOR129-1, Olfr1377
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258913
Homologene: 64929
Wfdc1
Name: WAP four-disulfide core domain 1
Synonyms: 2310058A03Rik, ps20
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67866
Homologene: 10920
Gm16853
Name: predicted gene, 16853
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330902
VEGA: 9
Pcdhga4
Name: protocadherin gamma subfamily A, 4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93712
HGNC: HGNC:8702
Homologene: 81866
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 49,244,665 bp
  • A to G, chromosome 1 at 116,101,574 bp
  • T to C, chromosome 1 at 173,459,851 bp
  • A to G, chromosome 1 at 174,214,066 bp
  • T to C, chromosome 2 at 30,443,305 bp
  • A to G, chromosome 2 at 38,550,637 bp
  • T to C, chromosome 2 at 127,433,622 bp
  • C to T, chromosome 3 at 58,539,629 bp
  • T to C, chromosome 3 at 72,921,184 bp
  • A to G, chromosome 3 at 123,485,485 bp
  • T to C, chromosome 4 at 43,942,293 bp
  • T to A, chromosome 4 at 45,284,382 bp
  • T to A, chromosome 4 at 94,652,912 bp
  • C to A, chromosome 4 at 116,080,546 bp
  • C to G, chromosome 4 at 117,111,206 bp
  • T to A, chromosome 4 at 147,058,697 bp
  • G to A, chromosome 5 at 30,197,369 bp
  • G to A, chromosome 5 at 72,700,663 bp
  • A to T, chromosome 5 at 92,623,396 bp
  • A to T, chromosome 5 at 110,649,872 bp
  • G to T, chromosome 5 at 125,277,795 bp
  • G to C, chromosome 5 at 136,988,146 bp
  • C to A, chromosome 5 at 151,092,829 bp
  • A to T, chromosome 6 at 23,109,498 bp
  • C to A, chromosome 6 at 128,981,324 bp
  • T to G, chromosome 7 at 6,305,106 bp
  • G to T, chromosome 7 at 24,925,846 bp
  • G to A, chromosome 7 at 43,692,077 bp
  • T to C, chromosome 7 at 46,998,581 bp
  • T to C, chromosome 7 at 141,259,720 bp
  • T to A, chromosome 7 at 144,457,724 bp
  • A to G, chromosome 8 at 10,562,240 bp
  • A to G, chromosome 8 at 25,946,343 bp
  • T to A, chromosome 8 at 119,683,793 bp
  • T to C, chromosome 8 at 122,270,436 bp
  • A to G, chromosome 9 at 21,403,134 bp
  • A to C, chromosome 9 at 121,741,126 bp
  • G to A, chromosome 10 at 80,330,162 bp
  • G to A, chromosome 11 at 50,984,856 bp
  • C to T, chromosome 11 at 98,224,678 bp
  • A to G, chromosome 12 at 51,431,519 bp
  • G to T, chromosome 12 at 55,304,613 bp
  • A to G, chromosome 12 at 72,084,604 bp
  • G to T, chromosome 12 at 76,577,981 bp
  • A to T, chromosome 13 at 55,004,481 bp
  • A to G, chromosome 13 at 55,301,809 bp
  • A to T, chromosome 13 at 100,299,307 bp
  • G to T, chromosome 14 at 66,143,417 bp
  • C to A, chromosome 14 at 66,143,424 bp
  • T to C, chromosome 14 at 68,520,539 bp
  • T to C, chromosome 15 at 4,990,464 bp
  • G to A, chromosome 15 at 12,162,233 bp
  • C to T, chromosome 15 at 36,107,076 bp
  • T to C, chromosome 15 at 44,718,943 bp
  • T to A, chromosome 15 at 72,941,947 bp
  • T to G, chromosome 15 at 83,608,747 bp
  • T to C, chromosome 15 at 84,557,001 bp
  • C to A, chromosome 16 at 14,224,059 bp
  • T to A, chromosome 16 at 58,465,373 bp
  • A to T, chromosome 16 at 59,074,256 bp
  • A to T, chromosome 16 at 96,683,772 bp
  • A to T, chromosome 17 at 46,988,722 bp
  • GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA, chromosome 17 at 52,725,906 bp
  • A to T, chromosome 18 at 37,685,779 bp
  • A to T, chromosome 18 at 39,775,530 bp
  • A to G, chromosome 18 at 74,740,488 bp
  • G to A, chromosome 19 at 3,941,959 bp
  • C to T, chromosome 19 at 6,940,423 bp
  • A to G, chromosome 19 at 39,802,529 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4080 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040856-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.