Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3884Btlr/Mmmh
Stock Number:
040797-MU
Citation ID:
RRID:MMRRC_040797-MU
Other Names:
R3884 (G1), C57BL/6J-MtgxR3884Btlr
Major Collection:

Strain Information

Nedd4
Name: neural precursor cell expressed, developmentally down-regulated 4
Synonyms: Nedd4-1, Nedd4, Nedd4a, E430025J12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17999
HGNC: HGNC:7727
Homologene: 134533
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Cnot7
Name: CCR4-NOT transcription complex, subunit 7
Synonyms: Caf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18983
Homologene: 49011
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101540
Homologene: 9516
Lin9
Name: lin-9 DREAM MuvB core complex component
Synonyms: 2700022J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72568
Homologene: 35252
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Epb41l3
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, 4.1B, DAL1P, Epb4.1l3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13823
HGNC: HGNC:3380
Homologene: 49308
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: mZ13, Miz1, Zfp100
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22642
Homologene: 2575
Naa16
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66897
Homologene: 134838
Rock1
Name: Rho-associated coiled-coil containing protein kinase 1
Synonyms: Rock-I, 1110055K06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19877
VEGA: 18
Homologene: 55899
Cntn2
Name: contactin 2
Synonyms: Tax, TAG-1, axonin, D130012K04Rik, TAG1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21367
HGNC: HGNC:2172
Homologene: 3720
Neurl1a
Name: neuralized E3 ubiquitin protein ligase 1A
Synonyms: Nlz, 2410129E16Rik, Neu1, Rnf67, Neur1, Neurl
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18011
VEGA: 19
HGNC: HGNC:7761
Homologene: 32503
Pacs1
Name: phosphofurin acidic cluster sorting protein 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107975
VEGA: 19
Homologene: 9970
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, PTPsigma, RPTPsigma, Ptpt9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Smad3
Name: SMAD family member 3
Synonyms: Smad 3, Madh3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17127
HGNC: HGNC:6769
Homologene: 55937
F2
Name: coagulation factor II
Synonyms: prothrombin, Cf-2, Cf2, FII, thrombin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14061
HGNC: HGNC:3535
Homologene: 426
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Myl3
Name: myosin, light polypeptide 3
Synonyms: MLC1v, MLC1s, Mylc, slow skeletal, ventricular, alkali
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17897
HGNC: HGNC:7584
Homologene: 20099
Ankrd52
Name: ankyrin repeat domain 52
Synonyms: G431002C21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237615
Homologene: 18227
Or6c210
Name: olfactory receptor family 6 subfamily C member 210
Synonyms: GA_x6K02T2PULF-11338429-11339364, MOR114-7, Olfr800
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258541
Homologene: 27203
Or10a2
Name: olfactory receptor family 10 subfamily A member 2
Synonyms: GA_x6K02T2PBJ9-9453401-9454354, MOR263-2, P4, Olfr714
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259035
Homologene: 72055
Gm9839
Name: predicted gene 9839
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 408192
Homologene: 130042
Slc38a7
Name: solute carrier family 38, member 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234595
Homologene: 41237
Atp6v0d2
Name: ATPase, H+ transporting, lysosomal V0 subunit D2
Synonyms: 1620401A02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242341
Homologene: 72090
Adcy6
Name: adenylate cyclase 6
Synonyms: AC6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11512
VEGA: 15
HGNC: HGNC:237
Homologene: 22400
Plxnc1
Name: plexin C1
Synonyms: vespr, CD232, 2510048K12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Parl
Name: presenilin associated, rhomboid-like
Synonyms: PSENIP2, PRO2207, PSARL1, D16Ertd607e, Psarl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 381038
Homologene: 10239
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241158
Homologene: 9561
Xylb
Name: xylulokinase homolog (H. influenzae)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102448
VEGA: 9
Homologene: 3746
Ace
Name: angiotensin I converting enzyme
Synonyms: CD143
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11421
HGNC: HGNC:2707
Homologene: 37351
Lyg2
Name: lysozyme G-like 2
Synonyms: LOC332427
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 332427
Homologene: 18483
Asb18
Name: ankyrin repeat and SOCS box-containing 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208372
Homologene: 16382
Klk1b16
Name: kallikrein 1-related peptidase b16
Synonyms: mGk-16, Klk16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16615
Homologene: 68141
Bhlhe41
Name: basic helix-loop-helix family, member e41
Synonyms: DEC2, Sharp1, Bhlhb3, 6430520M22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 79362
Homologene: 137371
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Selenon
Name: selenoprotein N
Synonyms: 1110019I12Rik, Sepn1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74777
Homologene: 10723
Gabra4
Name: gamma-aminobutyric acid type A receptor subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Gm9925
Name: predicted gene 9925
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 433202
VEGA: 18
Prss44
Name: serine protease 44
Synonyms: TESSP4, 1700036D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73336
Homologene: 135977
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 32,520,662 bp
  • C to G, chromosome 1 at 37,910,069 bp
  • A to G, chromosome 1 at 59,185,568 bp
  • G to T, chromosome 1 at 89,990,584 bp
  • T to G, chromosome 1 at 92,886,152 bp
  • A to G, chromosome 1 at 132,528,939 bp
  • G to T, chromosome 1 at 180,688,065 bp
  • T to A, chromosome 2 at 76,730,361 bp
  • A to T, chromosome 2 at 91,630,138 bp
  • T to A, chromosome 4 at 19,910,677 bp
  • T to C, chromosome 4 at 134,539,770 bp
  • T to C, chromosome 4 at 141,464,575 bp
  • G to A, chromosome 5 at 32,944,077 bp
  • T to C, chromosome 5 at 71,657,257 bp
  • A to G, chromosome 6 at 121,347,003 bp
  • A to G, chromosome 6 at 145,864,563 bp
  • C to A, chromosome 7 at 16,853,255 bp
  • T to C, chromosome 7 at 44,139,463 bp
  • C to T, chromosome 7 at 45,321,998 bp
  • A to T, chromosome 7 at 107,073,903 bp
  • A to T, chromosome 8 at 40,510,130 bp
  • C to T, chromosome 8 at 95,846,181 bp
  • A to G, chromosome 9 at 63,666,142 bp
  • C to T, chromosome 9 at 72,725,077 bp
  • A to G, chromosome 9 at 110,767,959 bp
  • T to C, chromosome 9 at 110,814,696 bp
  • T to C, chromosome 9 at 119,380,687 bp
  • A to T, chromosome 10 at 94,910,687 bp
  • A to G, chromosome 10 at 128,388,955 bp
  • T to C, chromosome 10 at 129,660,538 bp
  • T to C, chromosome 11 at 3,227,382 bp
  • T to C, chromosome 11 at 105,974,660 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • G to T, chromosome 13 at 9,551,858 bp
  • T to A, chromosome 14 at 41,966,987 bp
  • T to C, chromosome 14 at 79,343,262 bp
  • A to C, chromosome 14 at 103,295,250 bp
  • G to A, chromosome 15 at 98,597,174 bp
  • A to T, chromosome 16 at 20,283,012 bp
  • T to A, chromosome 17 at 12,709,468 bp
  • T to C, chromosome 17 at 56,424,871 bp
  • T to C, chromosome 17 at 57,217,173 bp
  • C to T, chromosome 17 at 69,274,116 bp
  • G to A, chromosome 18 at 10,122,768 bp
  • G to A, chromosome 18 at 60,916,651 bp
  • T to C, chromosome 18 at 74,065,328 bp
  • T to C, chromosome 19 at 5,155,759 bp
  • T to C, chromosome 19 at 47,253,446 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3884 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040797-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.