Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3806Btlr/Mmmh
Stock Number:
040763-MU
Citation ID:
RRID:MMRRC_040763-MU
Other Names:
R3806 (G1), C57BL/6J-MtgxR3806Btlr
Major Collection:

Strain Information

Pofut2
Name: protein O-fucosyltransferase 2
Synonyms: FUT13, 2310011G23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 80294
VEGA: 10
Homologene: 12724
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Fam131a
Name: family with sequence similarity 131, member A
Synonyms: 2900046G09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78408
Homologene: 82234
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68926
Homologene: 73649
Clcnka
Name: chloride channel, voltage-sensitive Ka
Synonyms: CLC-K1, Clcnk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12733
Homologene: 65
Maco1
Name: macoilin 1
Synonyms: 9230118A01Rik, C61, 1110007C24Rik, Tmem57
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66146
Homologene: 14449
Morf4l1
Name: mortality factor 4 like 1
Synonyms: TEG-189, MRG15, MORFRG15, Tex189
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21761
Homologene: 86043
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Psmd12
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms: P55, 1500002F15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66997
HGNC: HGNC:9557
Homologene: 2109
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Bbs9
Name: Bardet-Biedl syndrome 9
Synonyms: EST 3159894, E130103I17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319845
Homologene: 44480
Them6
Name: thioesterase superfamily member 6
Synonyms: 4930572J05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223626
Homologene: 105296
Cpxm2
Name: carboxypeptidase X, M14 family member 2
Synonyms: 4632435C11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55987
Homologene: 69259
Rab6a
Name: RAB6A, member RAS oncogene family
Synonyms: 2610028L11Rik, Rab6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19346
HGNC: HGNC:9786
Homologene: 55697
Lamtor1
Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Synonyms: p18, 2400001E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66508
Homologene: 9909
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: P130, NOPP140, 3230402K17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70769
VEGA: 19
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Mgat4c
Name: MGAT4 family, member C
Synonyms: 9130411I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67569
Homologene: 8297
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Ruvbl2
Name: RuvB-like AAA ATPase 2
Synonyms: p47, mp47
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20174
Homologene: 4856
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Col1a-2, Cola2, Cola-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Cercam
Name: cerebral endothelial cell adhesion molecule
Synonyms: CerCAM, Ceecam1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99151
Homologene: 22954
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Ccdc175
Name: coiled-coil domain containing 175
Synonyms: 4930403N07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73936
VEGA: 12
Homologene: 79144
Slc4a1
Name: solute carrier family 4 (anion exchanger), member 1
Synonyms: erythrocyte membrane protein band 3, band 3, Empb3, Ae1, CD233, l11Jus51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20533
Homologene: 133556
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Or5d18
Name: olfactory receptor family 5 subfamily D member 18
Synonyms: mOR-EG, MOR174-9, GA_x6K02T2Q125-49527073-49526132, Olfr73
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 117004
Homologene: 133889
Lrrc7
Name: leucine rich repeat containing 7
Synonyms: densin, B230334C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242274
Homologene: 10817
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: EG638102, V2Rp4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Slc24a2
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms: 6330417K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76376
Homologene: 10669
Fer1l4
Name: fer-1 like family member 4
Synonyms: 9130402C12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74562
Homologene: 19075
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Lingo4
Name: leucine rich repeat and Ig domain containing 4
Synonyms: A530050P17Rik, Lrrn6d, LERN4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320747
Homologene: 18563
Zfp235
Name: zinc finger protein 235
Synonyms: 0610030O19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56525
Homologene: 122146
Syt16
Name: synaptotagmin XVI
Synonyms: Strep14, syt14r, Syt14l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238266
VEGA: 12
Homologene: 12902
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Cfhr4
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214403
HGNC: HGNC:4883
Dhrs2
Name: dehydrogenase/reductase member 2
Synonyms: SDR family, 5430405K24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71412
Homologene: 69438
Or4ac1-ps1
Name: olfactory receptor family 4 subfamily AC member 1, pseudogene 1
Synonyms: GA_x6K02T2Q125-50027818-50027495, Olfr1187-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 404484
VEGA: 2
Ip6k3
Name: inositol hexaphosphate kinase 3
Synonyms: D830007E07Rik, Ihpk3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 271424
Homologene: 65257
Man1c1
Name: mannosidase, alpha, class 1C, member 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230815
Homologene: 69303
Ripk3
Name: receptor-interacting serine-threonine kinase 3
Synonyms: Rip3, 2610528K09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56532
VEGA: 14
Homologene: 31410
Hdac10
Name: histone deacetylase 10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170787
Homologene: 23749
Krt16
Name: keratin 16
Synonyms: K16, Krt1-16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16666
HGNC: HGNC:6423
Homologene: 21145
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23968
Homologene: 65105
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241158
Homologene: 9561
Psg16
Name: pregnancy specific beta-1-glycoprotein 16
Synonyms: bCEA, Cea11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26436
Rxylt1
Name: ribitol xylosyltransferase 1
Synonyms: 6330415D21Rik, Tmem5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216395
Homologene: 8600
Fbxl15
Name: F-box and leucine-rich repeat protein 15
Synonyms: 0710008C12Rik, Fbxo37
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68431
VEGA: 19
Homologene: 44220
Zbtb22
Name: zinc finger and BTB domain containing 22
Synonyms: Bing1, 1110008J20Rik, Zfp297
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81630
Homologene: 3982
Fcrlb
Name: Fc receptor-like B
Synonyms: FREB-2, FREB2, FcRL2, Fcry, mFCRL2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435653
Homologene: 83202
Gem
Name: GTP binding protein overexpressed in skeletal muscle
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14579
HGNC: HGNC:4234
Homologene: 38024
Hemk1
Name: HemK methyltransferase family member 1
Synonyms: 2310008M14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69536
Homologene: 6815
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 92,883,758 bp
  • T to A, chromosome 1 at 139,753,035 bp
  • T to C, chromosome 1 at 170,907,614 bp
  • G to T, chromosome 2 at 29,872,708 bp
  • A to G, chromosome 2 at 88,034,567 bp
  • A to T, chromosome 2 at 88,540,356 bp
  • C to T, chromosome 2 at 156,045,683 bp
  • A to G, chromosome 3 at 94,402,100 bp
  • T to C, chromosome 3 at 158,185,493 bp
  • C to T, chromosome 4 at 11,705,965 bp
  • A to C, chromosome 4 at 41,196,056 bp
  • A to T, chromosome 4 at 87,227,784 bp
  • A to T, chromosome 4 at 134,703,351 bp
  • C to T, chromosome 4 at 134,830,580 bp
  • T to C, chromosome 4 at 141,387,290 bp
  • T to A, chromosome 5 at 30,386,499 bp
  • G to A, chromosome 5 at 142,787,274 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • C to A, chromosome 6 at 58,916,850 bp
  • T to C, chromosome 6 at 146,232,291 bp
  • T to A, chromosome 6 at 149,518,991 bp
  • A to G, chromosome 7 at 17,090,684 bp
  • A to G, chromosome 7 at 23,404,846 bp
  • A to G, chromosome 7 at 24,140,621 bp
  • A to G, chromosome 7 at 45,422,190 bp
  • A to G, chromosome 7 at 100,608,224 bp
  • G to A, chromosome 7 at 101,911,345 bp
  • C to T, chromosome 7 at 132,080,091 bp
  • T to C, chromosome 7 at 141,813,734 bp
  • G to A, chromosome 9 at 15,998,271 bp
  • T to A, chromosome 9 at 22,887,630 bp
  • A to T, chromosome 9 at 37,404,438 bp
  • C to T, chromosome 9 at 44,820,356 bp
  • A to G, chromosome 9 at 90,095,143 bp
  • T to A, chromosome 9 at 107,337,030 bp
  • T to C, chromosome 10 at 77,260,806 bp
  • A to G, chromosome 10 at 102,388,360 bp
  • A to T, chromosome 10 at 122,081,609 bp
  • A to C, chromosome 11 at 86,706,655 bp
  • G to T, chromosome 11 at 100,248,740 bp
  • T to C, chromosome 11 at 102,357,193 bp
  • T to G, chromosome 11 at 107,495,765 bp
  • G to T, chromosome 11 at 109,794,154 bp
  • G to A, chromosome 12 at 13,482,504 bp
  • T to C, chromosome 12 at 72,180,824 bp
  • A to G, chromosome 12 at 74,229,398 bp
  • A to G, chromosome 12 at 81,950,137 bp
  • T to A, chromosome 13 at 100,152,634 bp
  • A to T, chromosome 14 at 55,234,748 bp
  • T to C, chromosome 14 at 55,786,268 bp
  • A to G, chromosome 15 at 74,721,518 bp
  • T to C, chromosome 15 at 89,123,557 bp
  • G to A, chromosome 16 at 20,695,858 bp
  • ATCTTCT to ATCT, chromosome 17 at 23,359,988 bp
  • T to C, chromosome 17 at 27,145,000 bp
  • C to T, chromosome 17 at 33,916,946 bp
  • CCAGCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 19 at 46,081,352 bp
  • G to C, chromosome 19 at 46,329,452 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3806 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040763-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.