Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3703Btlr/Mmmh
Stock Number:
040696-MU
Citation ID:
RRID:MMRRC_040696-MU
Other Names:
R3703 (G1), C57BL/6J-MtgxR3703Btlr
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Arhgap10
Name: Rho GTPase activating protein 10
Synonyms: PSGAP-s, PSGAP-m, A930033B01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78514
Homologene: 12695
Trdmt1
Name: tRNA aspartic acid methyltransferase 1
Synonyms: Rnmt2, Dnmt2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13434
HGNC: HGNC:2977
Homologene: 3249
Bcap29
Name: B cell receptor associated protein 29
Synonyms: Bap29
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12033
VEGA: 12
Homologene: 22411
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Rab1a
Name: RAB1A, member RAS oncogene family
Synonyms: ras-related YPT1 protein, Ypt1, Rab-1, Gtbp, Rab1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19324
HGNC: HGNC:9758
Homologene: 36154
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Nt5c3
Name: 5'-nucleotidase, cytosolic III
Synonyms: p36, lupin, Umph-1, PN-1, cN-III, PSN1, PN-I, Umph1, 2610206B05Rik, 1600024P05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107569
Homologene: 9534
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Rasa3
Name: RAS p21 protein activator 3
Synonyms: GAPIII activator 3, Ras GTPase-activating protein III, GAPIII, R-Ras gap, scat, hlb381
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19414
Homologene: 7217
Snx9
Name: sorting nexin 9
Synonyms: SH3PX1, SDP1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66616
VEGA: 17
Homologene: 49454
Dnajc19
Name: DnaJ heat shock protein family (Hsp40) member C19
Synonyms: 1810055D05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67713
Homologene: 87176
Sympk
Name: symplekin
Synonyms: 4632415H16Rik, 1500016F02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68188
Homologene: 37969
Hnrnpul2
Name: heterogeneous nuclear ribonucleoprotein U-like 2
Synonyms: 1110031M08Rik, Hnrpul2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68693
VEGA: 19
Homologene: 28583
Asap3
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: UPLC1, 9430088F20Rik, Ddefl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230837
Homologene: 41190
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Col13a1
Name: collagen, type XIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12817
HGNC: HGNC:2190
Homologene: 22421
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Tmem63a
Name: transmembrane protein 63a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208795
Homologene: 101673
Csrp2
Name: cysteine and glycine-rich protein 2
Synonyms: SmLim, Crp2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13008
VEGA: 10
HGNC: HGNC:2470
Homologene: 111061
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Cdh12
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 215654
HGNC: HGNC:1751
Homologene: 37873
Ifi207
Name: interferon activated gene 207
Synonyms: AI607873, Pyhin-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Hpd
Name: 4-hydroxyphenylpyruvic acid dioxygenase
Synonyms: Hppd, Laf, Flp, Fla
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15445
HGNC: HGNC:5147
Homologene: 1620
Pklr
Name: pyruvate kinase liver and red blood cell
Synonyms: Pk1, Pk-1, R-PK
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18770
HGNC: HGNC:9020
Homologene: 37286
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17836
HGNC: HGNC:9750
Homologene: 136663
Brf1
Name: BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
Synonyms: TAF3C, TFIIIB90, GTF3B, TAFIII90, 2510002F24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72308
VEGA: 12
Homologene: 1161
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Ifi47
Name: interferon gamma inducible protein 47
Synonyms: 47kDa, IRG-47, Iigp4, Igrd
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15953
Homologene: 49169
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Gpnmb
Name: glycoprotein (transmembrane) nmb
Synonyms: Dchil, Osteoactivin, DC-HIL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93695
HGNC: HGNC:4462
Homologene: 1880
Gtpbp3
Name: GTP binding protein 3
Synonyms: Gtpbp3, 2410009F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70359
Homologene: 6600
Zfr2
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103406
Homologene: 88124
Kcnq3
Name: potassium voltage-gated channel, subfamily Q, member 3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110862
HGNC: HGNC:6297
Homologene: 20949
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, T1r2, Gpr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83770
Homologene: 75323
Edil3
Name: EGF-like repeats and discoidin I-like domains 3
Synonyms: Del1, developmental endothelial locus-1, Del-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13612
HGNC: HGNC:3173
Homologene: 21166
Fbxl7
Name: F-box and leucine-rich repeat protein 7
Synonyms: Fbl6, FBL7, D230018M15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 448987
VEGA: 15
Homologene: 69121
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77018
Homologene: 57111
Naa30
Name: N(alpha)-acetyltransferase 30, NatC catalytic subunit
Synonyms: 5730533P17Rik, 4930487N19Rik, Nat12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70646
Homologene: 17947
Btnl7-ps
Name: butyrophilin-like 7, pseudogene
Synonyms: Btnl7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 195349
Spns3
Name: SPNS lysolipid transporter 3, sphingosine-1-phosphate (putative)
Synonyms: 9830002I17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77577
Homologene: 45648
Tox3
Name: TOX high mobility group box family member 3
Synonyms: CAGF9, Tnrc9, 500-9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244579
Homologene: 18257
Ctla2a
Name: cytotoxic T lymphocyte-associated protein 2 alpha
Synonyms: Ctla-2a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13024
VEGA: 13
Homologene: 130627
Rdh8
Name: retinol dehydrogenase 8
Synonyms: LOC235033, prRDH
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235033
VEGA: 9
Homologene: 41062
Nap1l3
Name: nucleosome assembly protein 1-like 3
Synonyms: MB20
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 54561
HGNC: HGNC:7639
Homologene: 3334
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 162,710,691 bp
  • A to T, chromosome 1 at 173,727,463 bp
  • G to A, chromosome 1 at 180,963,114 bp
  • T to A, chromosome 2 at 13,350,943 bp
  • T to A, chromosome 2 at 13,521,297 bp
  • A to T, chromosome 2 at 76,735,408 bp
  • A to G, chromosome 3 at 34,080,229 bp
  • T to A, chromosome 3 at 36,987,581 bp
  • C to T, chromosome 3 at 89,142,701 bp
  • A to G, chromosome 3 at 130,550,033 bp
  • TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGAGGAGGA, chromosome 4 at 136,241,241 bp
  • G to A, chromosome 4 at 139,667,418 bp
  • G to A, chromosome 5 at 123,181,846 bp
  • T to A, chromosome 6 at 49,051,865 bp
  • A to G, chromosome 6 at 56,883,667 bp
  • G to T, chromosome 6 at 110,646,348 bp
  • C to T, chromosome 6 at 121,888,556 bp
  • A to G, chromosome 7 at 19,040,561 bp
  • A to T, chromosome 8 at 13,588,972 bp
  • T to G, chromosome 8 at 71,492,135 bp
  • C to T, chromosome 8 at 77,259,056 bp
  • G to T, chromosome 8 at 90,248,905 bp
  • G to A, chromosome 8 at 95,104,028 bp
  • T to A, chromosome 8 at 107,351,421 bp
  • C to T, chromosome 9 at 20,823,333 bp
  • A to G, chromosome 10 at 61,867,829 bp
  • T to G, chromosome 10 at 81,246,079 bp
  • G to A, chromosome 10 at 110,937,874 bp
  • T to G, chromosome 11 at 20,224,506 bp
  • T to C, chromosome 11 at 49,095,525 bp
  • A to G, chromosome 11 at 67,189,601 bp
  • C to T, chromosome 11 at 72,499,530 bp
  • G to A, chromosome 11 at 74,083,319 bp
  • T to C, chromosome 12 at 31,617,152 bp
  • T to C, chromosome 12 at 112,969,371 bp
  • T to A, chromosome 13 at 60,936,007 bp
  • A to T, chromosome 13 at 89,177,298 bp
  • A to G, chromosome 14 at 31,176,745 bp
  • A to G, chromosome 14 at 49,187,602 bp
  • C to A, chromosome 15 at 21,583,826 bp
  • C to A, chromosome 15 at 26,543,755 bp
  • A to G, chromosome 15 at 66,021,739 bp
  • G to C, chromosome 16 at 32,753,919 bp
  • T to C, chromosome 16 at 79,054,142 bp
  • T to A, chromosome 17 at 5,928,200 bp
  • T to A, chromosome 17 at 34,533,967 bp
  • A to G, chromosome 19 at 8,824,409 bp
  • A to T, chromosome X at 122,395,524 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3703 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040696-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.