Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3412Btlr/Mmmh
Stock Number:
040630-MU
Citation ID:
RRID:MMRRC_040630-MU
Other Names:
R3412 (G1), C57BL/6J-MtgxR3412Btlr
Major Collection:

Strain Information

Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57138
Homologene: 10665
Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Il4i1
Name: interleukin 4 induced 1
Synonyms: Fig1-ps, Fig1, H46, H4, H-46, H-4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14204
Homologene: 22567
Mthfd1
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
Synonyms: Mthfd, DCS, E430024A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108156
VEGA: 12
HGNC: HGNC:7432
Homologene: 55940
Zmynd8
Name: zinc finger, MYND-type containing 8
Synonyms: 1110013E22Rik, 2010005I16Rik, ZMYND8, RACK7, 3632413B07Rik, Prkcbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228880
HGNC: HGNC:9397
Homologene: 32679
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Exoc4
Name: exocyst complex component 4
Synonyms: Sec8, Sec8l1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20336
Homologene: 40654
Ap2a2
Name: adaptor-related protein complex 2, alpha 2 subunit
Synonyms: alpha-C adaptin, alpha-adaptin C, L25, Adtab, 2410074K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11772
HGNC: HGNC:562
Homologene: 5335
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57752
Homologene: 5087
Tex9
Name: testis expressed gene 9
Synonyms: tsec-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21778
Homologene: 32072
Utp25
Name: UTP25 small subunit processome component
Synonyms: AA408296, Diexf, mDef
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215193
Homologene: 6170
Sos1
Name: SOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms: 4430401P03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20662
VEGA: 17
Homologene: 4117
Sez6l
Name: seizure related 6 homolog like
Synonyms: Acig1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56747
Homologene: 10895
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231125
Homologene: 15119
Rusc2
Name: RUN and SH3 domain containing 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100213
Homologene: 18967
Gckr
Name: glucokinase regulatory protein
Synonyms: GKRP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231103
HGNC: HGNC:4196
Homologene: 1139
Trim69
Name: tripartite motif-containing 69
Synonyms: 4921519C19Rik, Trif, Rnf36
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70928
Homologene: 18827
Prss43
Name: serine protease 43
Synonyms: LOC272643, Tessp3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272643
Homologene: 138484
Duxf4
Name: double homeobox family member 4
Synonyms: Duxf4, Gm4981
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 245263
Homologene: 134545
Arhgef5
Name: Rho guanine nucleotide exchange factor 5
Synonyms: 2210412D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54324
Homologene: 66300
Taok2
Name: TAO kinase 2
Synonyms: MAP3K17, TAO2, TAO1, PSK1, 1110033K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381921
Homologene: 74531
Or6c1b
Name: olfactory receptor family 6 subfamily C member 1B
Synonyms: GA_x6K02T2PULF-11116958-11117896, MOR111-5, Olfr786
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258542
HGNC: HGNC:8355
Homologene: 133582
Ppef2
Name: protein phosphatase, EF hand calcium-binding domain 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19023
HGNC: HGNC:9244
Homologene: 55959
Tusc1
Name: tumor suppressor candidate 1
Synonyms: 2200001D17Rik, TSG-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69136
Homologene: 84597
Krt90
Name: keratin 90
Synonyms: 4732456N10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239673
Homologene: 72272
Or51f5
Name: olfactory receptor family 51 subfamily F member 5
Synonyms: GA_x6K02T2PBJ9-5491151-5492095, MOR14-2, Olfr561
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259096
Homologene: 133029
Or51q1
Name: olfactory receptor family 51 subfamily Q member 1
Synonyms: GA_x6K02T2PBJ9-6713641-6714588, MOR5-2, Olfr635
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259122
Homologene: 133592
Adarb2
Name: adenosine deaminase, RNA-specific, B2
Synonyms: RED2, Adar3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94191
HGNC: HGNC:227
Homologene: 10276
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Rusf1
Name: RUS family member 1
Synonyms: BC017158
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233913
Homologene: 11232
Or5an1c
Name: olfactory receptor family 5 subfamily AN member 1C
Synonyms: GA_x6K02T2N4A9-18144-19082, MOR214-1, MOR214-9, Olfr262
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258683
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm29096, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Il18r1
Name: interleukin 18 receptor 1
Synonyms: Il1rrp, Il18ralpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16182
HGNC: HGNC:5988
Homologene: 2861
Pla2g4f
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271844
Homologene: 77933
Slc1a7
Name: solute carrier family 1 (glutamate transporter), member 7
Synonyms: EAAT5, A930031E15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242607
Homologene: 21327
AC127274.2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Spag8
Name: sperm associated antigen 8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433700
Homologene: 8250
Ramp2
Name: receptor (calcitonin) activity modifying protein 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54409
HGNC: HGNC:9844
Homologene: 4274
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 14,274,209 bp
  • A to T, chromosome 1 at 40,491,067 bp
  • C to A, chromosome 1 at 87,668,057 bp
  • A to C, chromosome 1 at 193,128,502 bp
  • T to C, chromosome 2 at 120,303,106 bp
  • T to C, chromosome 2 at 122,178,644 bp
  • C to A, chromosome 2 at 126,375,757 bp
  • A to G, chromosome 2 at 164,968,431 bp
  • A to T, chromosome 2 at 165,815,451 bp
  • T to G, chromosome 4 at 43,415,935 bp
  • T to A, chromosome 4 at 43,651,606 bp
  • C to A, chromosome 4 at 93,334,936 bp
  • A to G, chromosome 4 at 108,010,994 bp
  • T to A, chromosome 5 at 31,300,867 bp
  • C to T, chromosome 5 at 34,199,684 bp
  • T to G, chromosome 5 at 92,228,722 bp
  • A to G, chromosome 5 at 112,475,361 bp
  • A to G, chromosome 6 at 33,265,975 bp
  • A to G, chromosome 6 at 43,273,790 bp
  • T to C, chromosome 7 at 44,836,658 bp
  • T to C, chromosome 7 at 102,774,755 bp
  • T to C, chromosome 7 at 103,979,402 bp
  • T to C, chromosome 7 at 126,870,858 bp
  • T to C, chromosome 7 at 128,276,427 bp
  • A to G, chromosome 7 at 130,734,994 bp
  • T to A, chromosome 7 at 141,598,776 bp
  • T to A, chromosome 9 at 4,513,278 bp
  • C to A, chromosome 9 at 72,477,758 bp
  • G to C, chromosome 9 at 110,829,464 bp
  • T to C, chromosome 10 at 41,539,549 bp
  • G to A, chromosome 10 at 58,236,353 bp
  • A to T, chromosome 10 at 129,437,307 bp
  • TTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTG, chromosome 11 at 101,246,545 bp
  • A to G, chromosome 12 at 76,303,749 bp
  • T to C, chromosome 13 at 8,752,618 bp
  • T to C, chromosome 15 at 38,004,235 bp
  • T to A, chromosome 15 at 101,560,593 bp
  • T to A, chromosome 17 at 39,038,316 bp
  • T to C, chromosome 17 at 80,406,717 bp
  • T to C, chromosome 19 at 12,241,590 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3412 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040630-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.