Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3118Btlr/Mmmh
Stock Number:
040591-MU
Citation ID:
RRID:MMRRC_040591-MU
Other Names:
R3118 (G1), C57BL/6J-MtgxR3118Btlr
Major Collection:

Strain Information

Prss12
Name: serine protease 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19142
HGNC: HGNC:9477
Homologene: 7490
Rgs10
Name: regulator of G-protein signalling 10
Synonyms: 2310010N19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67865
HGNC: HGNC:9992
Homologene: 37710
Ece1
Name: endothelin converting enzyme 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230857
HGNC: HGNC:3146
Homologene: 1068
Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Chrna2
Name: cholinergic receptor nicotinic alpha 2 subunit
Synonyms: Acra-2, Acra2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110902
HGNC: HGNC:1956
Homologene: 20193
Crebbp
Name: CREB binding protein
Synonyms: CBP, KAT3A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12914
HGNC: HGNC:2348
Homologene: 68393
Prpf39
Name: pre-mRNA processing factor 39
Synonyms: Srcs1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328110
Homologene: 32377
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Ddx11
Name: DEAD/H box helicase 11
Synonyms: CHLR1, KRG2, CHL1, 4732462I11Rik, essa15a, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Lemd3
Name: LEM domain containing 3
Synonyms: Man1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380664
Homologene: 8633
Pak6
Name: p21 (RAC1) activated kinase 6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214230
Homologene: 23200
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: ADAM-TS6, A930019D11Rik, b2b2228Clo, b2b2187.1Clo, b2b2182Clo, b2b2029Clo, b2b1879.1Clo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Ccdc125
Name: coiled-coil domain containing 125
Synonyms: 5830436D01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76041
VEGA: 13
Homologene: 27932
Tbx15
Name: T-box 15
Synonyms: Tbx8, de, Tbx14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21384
Homologene: 7967
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435626
Homologene: 52359
Rnf19a
Name: ring finger protein 19A
Synonyms: XYbp, XY body protein, Rnf19, Dorfin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 30945
VEGA: 15
Homologene: 8501
Cpxm1
Name: carboxypeptidase X, M14 family member 1
Synonyms: Cpx-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56264
Homologene: 10485
Mkrn3
Name: makorin, ring finger protein, 3
Synonyms: D7H15S9-1, Zfp127
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22652
HGNC: HGNC:7114
Homologene: 4143
Gpr149
Name: G protein-coupled receptor 149
Synonyms: PGR10, 9630018L10Rik, Ieda, R35
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229357
Homologene: 16359
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Cxcl1
Name: C-X-C motif chemokine ligand 1
Synonyms: N51, Mgsa, Fsp, Scyb1, Gro1, KC/GRO-alpha, KC
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14825
Homologene: 105490
Mmp7
Name: matrix metallopeptidase 7
Synonyms: matrilysin, MAT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17393
HGNC: HGNC:7174
Homologene: 37619
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 74,147,663 bp
  • T to C, chromosome 2 at 118,689,741 bp
  • T to C, chromosome 2 at 130,393,573 bp
  • A to G, chromosome 3 at 62,595,022 bp
  • T to C, chromosome 3 at 99,352,154 bp
  • A to T, chromosome 3 at 123,505,327 bp
  • G to A, chromosome 4 at 104,680,069 bp
  • A to G, chromosome 4 at 137,948,544 bp
  • T to A, chromosome 5 at 90,891,595 bp
  • G to A, chromosome 5 at 96,771,712 bp
  • A to G, chromosome 6 at 89,356,976 bp
  • GAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA to GAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA, chromosome 6 at 93,693,932 bp
  • T to A, chromosome 7 at 3,841,677 bp
  • CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA to CGGCATTGGCACTGGCATTGGCA, chromosome 7 at 62,419,214 bp
  • T to C, chromosome 7 at 128,403,231 bp
  • C to T, chromosome 8 at 22,778,409 bp
  • T to C, chromosome 9 at 7,697,692 bp
  • A to G, chromosome 10 at 120,947,251 bp
  • T to C, chromosome 11 at 59,131,646 bp
  • T to C, chromosome 12 at 65,057,877 bp
  • C to T, chromosome 12 at 98,865,494 bp
  • T to C, chromosome 13 at 67,320,899 bp
  • T to C, chromosome 13 at 100,690,319 bp
  • T to G, chromosome 13 at 104,314,279 bp
  • A to G, chromosome 14 at 66,150,993 bp
  • T to A, chromosome 15 at 36,241,899 bp
  • G to A, chromosome 16 at 4,109,198 bp
  • T to A, chromosome 17 at 66,149,277 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3118 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040591-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.