Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2391Btlr/Mmmh
Stock Number:
040359-MU
Citation ID:
RRID:MMRRC_040359-MU
Other Names:
R2391 (G1), C57BL/6J-MtgxR2391Btlr
Major Collection:

Strain Information

Cdk18
Name: cyclin dependent kinase 18
Synonyms: Pctk3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18557
HGNC: HGNC:8751
Homologene: 1949
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Terf1
Name: telomeric repeat binding factor 1
Synonyms: Trf1, Trbf1, Pin2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21749
Homologene: 7570
Sfmbt2
Name: Scm-like with four mbt domains 2
Synonyms: D330030P06Rik, D2Wsu23e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 353282
Homologene: 82485
Ptpn2
Name: protein tyrosine phosphatase, non-receptor type 2
Synonyms: Ptpt, TC-PTP
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19255
HGNC: HGNC:9650
Homologene: 7497
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Naa16
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66897
Homologene: 134838
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
1110004F10Rik
Name: RIKEN cDNA 1110004F10 gene
Synonyms: sid2057
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56372
Homologene: 8606
Or51e2
Name: olfactory receptor family 51 subfamily E member 2
Synonyms: RA1c, PSGR, MOL2.3, 4633402A21Rik, MOR18-2, GA_x6K02T2PBJ9-5459657-5458695, Olfr78
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170639
Homologene: 23713
Znhit6
Name: zinc finger, HIT type 6
Synonyms: 2410019A14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229937
Homologene: 32378
Sugp1
Name: SURP and G patch domain containing 1
Synonyms: Sf4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70616
Homologene: 12360
Emp2
Name: epithelial membrane protein 2
Synonyms: Xmp
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13731
HGNC: HGNC:3334
Homologene: 1089
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57775
Homologene: 49641
Acss3
Name: acyl-CoA synthetase short-chain family member 3
Synonyms: LOC380660, 8430416H19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380660
Homologene: 11587
Capn2
Name: calpain 2
Synonyms: m-calpain, Capa-2, Capa2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12334
HGNC: HGNC:1479
Homologene: 1326
BC005537
Name: cDNA sequence BC005537
Synonyms: 8030460C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 79555
Homologene: 11551
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Slc6a20a
Name: solute carrier family 6 (neurotransmitter transporter), member 20A
Synonyms: A730081N20Rik, Xtrp3s1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102680
Homologene: 10625
Tas2r143
Name: taste receptor, type 2, member 143
Synonyms: mt2r36, Tas2r43
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387514
Homologene: 74285
Olfm5
Name: olfactomedin 5
Synonyms: E030002O03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244180
Homologene: 18253
Cimap1d
Name: CIMAP1 family member D
Synonyms: LOC382384, Odf3l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382384
VEGA: 10
Homologene: 16801
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Or10q3
Name: olfactory receptor family 10 subfamily Q member 3
Synonyms: GA_x6K02T2RE5P-2222521-2221490, MOR266-10, Olfr1419
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 257938
Homologene: 79473
Spon1
Name: spondin 1, (f-spondin) extracellular matrix protein
Synonyms: D330035F22Rik, FSP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233744
Homologene: 4453
Or6k8
Name: olfactory receptor family 6 subfamily K member 8
Synonyms: GA_x6K02T2P20D-21006310-21006124, GA_x6K02T2P20D-21002372-21001425, MOR105-3, Or6k8-ps1, Olfr421, Olfr422-ps1, Olfr421-ps1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 258715
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Retreg1
Name: reticulophagy regulator 1
Synonyms: 1810015C04Rik, Fam134b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66270
VEGA: 15
Homologene: 10368
Tssk5
Name: testis-specific serine kinase 5
Synonyms: 1700091F14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73542
VEGA: 15
Homologene: 18832
Trim12a
Name: tripartite motif-containing 12A
Synonyms: 2310043C01Rik, Trim12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76681
Gm2888
Name: predicted gene 2888
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100040657
Homologene: 115686
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 15,805,739 bp
  • TATACATACATACATACATACATACATACATAC to TATACATACATACATACATACATACATACATACATAC, chromosome 1 at 84,814,790 bp
  • A to G, chromosome 1 at 107,607,069 bp
  • G to T, chromosome 1 at 132,115,474 bp
  • T to C, chromosome 1 at 174,152,098 bp
  • T to C, chromosome 1 at 182,478,609 bp
  • T to C, chromosome 2 at 10,445,693 bp
  • A to G, chromosome 2 at 91,585,869 bp
  • A to G, chromosome 3 at 122,158,422 bp
  • T to C, chromosome 3 at 145,594,658 bp
  • C to T, chromosome 4 at 104,731,751 bp
  • C to A, chromosome 6 at 42,400,876 bp
  • T to A, chromosome 7 at 6,963,771 bp
  • C to A, chromosome 7 at 102,742,374 bp
  • A to G, chromosome 7 at 104,160,834 bp
  • T to C, chromosome 7 at 104,306,931 bp
  • C to T, chromosome 7 at 113,886,847 bp
  • T to A, chromosome 7 at 116,104,226 bp
  • T to A, chromosome 7 at 131,106,468 bp
  • T to C, chromosome 8 at 70,059,411 bp
  • A to T, chromosome 9 at 123,664,621 bp
  • A to T, chromosome 10 at 79,645,650 bp
  • T to G, chromosome 10 at 107,123,487 bp
  • A to G, chromosome 12 at 101,624,706 bp
  • T to A, chromosome 13 at 24,809,915 bp
  • A to T, chromosome 14 at 3,037,656 bp
  • A to T, chromosome 14 at 33,162,807 bp
  • T to A, chromosome 14 at 79,370,049 bp
  • T to G, chromosome 15 at 25,968,555 bp
  • T to C, chromosome 15 at 76,374,551 bp
  • A to T, chromosome 16 at 10,284,588 bp
  • G to A, chromosome 17 at 25,851,455 bp
  • A to T, chromosome 18 at 67,675,889 bp
  • G to T, chromosome 19 at 11,870,816 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2391 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040359-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.