Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2312Btlr/Mmmh
Stock Number:
040311-MU
Citation ID:
RRID:MMRRC_040311-MU
Other Names:
R2312 (G1), C57BL/6J-MtgxR2312Btlr
Major Collection:

Strain Information

Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Trappc9
Name: trafficking protein particle complex 9
Synonyms: 4632408O18Rik, 2900005P22Rik, Nibp, TRS130, 1810044A24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, 2010319N22Rik, E030041M21Rik, Uhrf1bp1l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231876
Homologene: 8948
Slc9a8
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms: NHE8, 1200006P13Rik, 6430709P13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77031
Homologene: 75041
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Tlr2
Name: toll-like receptor 2
Synonyms: Ly105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24088
Homologene: 20695
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72416
Homologene: 32695
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Rassf1
Name: Ras association (RalGDS/AF-6) domain family member 1
Synonyms: 123F protein, REH3P21, NORE2A, RDA32, Rassf1C, Rassf1B, Rassf1A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56289
HGNC: HGNC:9882
Homologene: 10499
Rxrb
Name: retinoid X receptor beta
Synonyms: RCoR-1, H-2RIIBP, Nr2b2, Rub
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20182
Homologene: 7923
Lpar1
Name: lysophosphatidic acid receptor 1
Synonyms: vzg-1, LPA1, Kdt2, Gpcr26, Edg2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14745
HGNC: HGNC:3166
Homologene: 1072
Prmt2
Name: protein arginine N-methyltransferase 2
Synonyms: Hrmt1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15468
HGNC: HGNC:5186
Homologene: 55587
Rab3b
Name: RAB3B, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69908
HGNC: HGNC:9778
Homologene: 2149
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, 2810425C21Rik, D13Ucla1, DAP-Kinase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Trpm2
Name: transient receptor potential cation channel, subfamily M, member 2
Synonyms: Trrp7, LTRPC2, TRPC7, 9830168K16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28240
Homologene: 20709
Mex3a
Name: mex3 RNA binding family member A
Synonyms: Rkhd4, 2700083E18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72640
Homologene: 18950
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Col1a-2, Cola2, Cola-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: vascular endothelial growth factor receptor-1, VEGFR-1, VEGFR1, Flt-1, sFlt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Astn2
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56079
Homologene: 77850
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 4632403N06Rik, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Kcnh2
Name: potassium voltage-gated channel, subfamily H (eag-related), member 2
Synonyms: merg1a, ether a go-go related, M-erg, LQT, Lqt2, ERG1, merg1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16511
HGNC: HGNC:6251
Homologene: 201
4732465J04Rik
Name: RIKEN cDNA 4732465J04 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 414105
Shkbp1
Name: Sh3kbp1 binding protein 1
Synonyms: SB1, B930062H15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 192192
Homologene: 26700
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Rnf130
Name: ring finger protein 130
Synonyms: G1RP, 2510042A13Rik, G1RZFP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 59044
Homologene: 41267
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213234
Homologene: 11661
Pcdhb7
Name: protocadherin beta 7
Synonyms: Pcdhb4B, PcdhbG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93878
HGNC: HGNC:8689
Homologene: 87123
Ttc14
Name: tetratricopeptide repeat domain 14
Synonyms: cI-44, 4931403I22Rik, 4933402I15Rik, 4930434D01Rik, 2700016E08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67120
Homologene: 12085
Cdhr4
Name: cadherin-related family member 4
Synonyms: D330022A01Rik, 1700021K14Rik, Cdh29
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69398
Homologene: 82362
Vmn2r112
Name: vomeronasal 2, receptor 112
Synonyms: EG628185
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 628185
Homologene: 86604
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Wnt10a
Name: wingless-type MMTV integration site family, member 10A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22409
Homologene: 22525
Serpine2
Name: serine (or cysteine) peptidase inhibitor, clade E, member 2
Synonyms: nexin, PN-1, PI7, protease nexin 1, Spi4, B230326M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20720
HGNC: HGNC:8951
Homologene: 21247
Pfkm
Name: phosphofructokinase, muscle
Synonyms: Pfk-4, Pfk4, PFK-M, PFK-A, Pfkx
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18642
VEGA: 15
HGNC: HGNC:8877
Homologene: 20101
Rmnd1
Name: required for meiotic nuclear division 1 homolog
Synonyms: 0610042C05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66084
Homologene: 5675
Eya4
Name: EYA transcriptional coactivator and phosphatase 4
Synonyms: B130023L16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14051
VEGA: 10
HGNC: HGNC:3522
Homologene: 3025
Or52r1c
Name: olfactory receptor family 52 subfamily R member 1C
Synonyms: GA_x6K02T2PBJ9-5796876-5797820, MOR30-2, Olfr584
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259056
Prx
Name: periaxin
Synonyms: L-Periaxin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19153
Homologene: 76542
Tmod2
Name: tropomodulin 2
Synonyms: NTMOD, N-Tmod, neural tropomodulin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50876
VEGA: 9
Homologene: 22817
Crygf
Name: crystallin, gamma F
Synonyms: Len-2, DGcry-2, Cryg-2, 3110001K11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12969
HGNC: HGNC:2411
Homologene: 128417
Zpbp2
Name: zona pellucida binding protein 2
Synonyms: 1700017D11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69376
Homologene: 18892
Ptgdr
Name: prostaglandin D receptor
Synonyms: DP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19214
HGNC: HGNC:9591
Homologene: 736
Vmn1r220
Name: vomeronasal 1 receptor 220
Synonyms: V1rh12
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171271
Homologene: 110880
H1f10
Name: H1.10 linker histone
Synonyms: LOC243529, H1X, H1-10, H1fx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243529
HGNC: HGNC:4722
Homologene: 4397
Spaca3
Name: sperm acrosome associated 3
Synonyms: ALLP17, SLLP1, 1700025M08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75622
Homologene: 18365
Arrb2
Name: arrestin, beta 2
Synonyms: beta arr2, beta-arrestin-2, beta-arrestin2, arrestin 3, Arr3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216869
HGNC: HGNC:712
Homologene: 3183
Rhobtb1
Name: Rho-related BTB domain containing 1
Synonyms: 1700008H16Rik, 3110048G13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69288
Homologene: 8892
Vegfb
Name: vascular endothelial growth factor B
Synonyms: VEGF-B, Vrf
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22340
Homologene: 87131
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,935,782 bp
  • A to T, chromosome 1 at 65,926,558 bp
  • C to A, chromosome 1 at 74,803,430 bp
  • A to T, chromosome 1 at 79,802,853 bp
  • A to G, chromosome 1 at 93,006,809 bp
  • C to T, chromosome 2 at 145,860,446 bp
  • T to A, chromosome 2 at 167,451,276 bp
  • A to G, chromosome 3 at 33,807,835 bp
  • A to T, chromosome 3 at 75,085,558 bp
  • A to G, chromosome 3 at 83,837,540 bp
  • A to G, chromosome 3 at 88,536,478 bp
  • A to C, chromosome 4 at 58,487,168 bp
  • A to G, chromosome 4 at 65,950,305 bp
  • G to A, chromosome 4 at 80,837,564 bp
  • A to G, chromosome 4 at 108,890,494 bp
  • T to C, chromosome 4 at 113,238,142 bp
  • A to G, chromosome 5 at 24,324,954 bp
  • C to T, chromosome 5 at 110,789,357 bp
  • T to C, chromosome 5 at 144,173,626 bp
  • T to C, chromosome 5 at 147,683,811 bp
  • G to A, chromosome 6 at 4,518,822 bp
  • T to C, chromosome 6 at 87,981,148 bp
  • A to G, chromosome 6 at 113,533,874 bp
  • T to C, chromosome 7 at 27,351,683 bp
  • T to C, chromosome 7 at 27,516,626 bp
  • A to G, chromosome 7 at 103,086,426 bp
  • C to A, chromosome 9 at 66,508,281 bp
  • A to G, chromosome 9 at 75,586,184 bp
  • C to G, chromosome 9 at 86,521,442 bp
  • T to C, chromosome 9 at 107,557,550 bp
  • G to A, chromosome 9 at 107,995,287 bp
  • A to T, chromosome 10 at 4,427,466 bp
  • A to G, chromosome 10 at 23,106,264 bp
  • A to T, chromosome 10 at 67,238,850 bp
  • C to A, chromosome 10 at 69,270,463 bp
  • G to A, chromosome 10 at 76,226,255 bp
  • C to A, chromosome 10 at 77,918,964 bp
  • A to G, chromosome 10 at 89,781,133 bp
  • GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT to GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT, chromosome 10 at 95,793,779 bp
  • T to C, chromosome 11 at 3,532,869 bp
  • T to C, chromosome 11 at 30,154,249 bp
  • T to A, chromosome 11 at 50,087,463 bp
  • T to A, chromosome 11 at 70,436,388 bp
  • A to T, chromosome 11 at 80,863,211 bp
  • T to A, chromosome 11 at 98,554,779 bp
  • G to T, chromosome 13 at 11,738,242 bp
  • A to G, chromosome 13 at 13,500,493 bp
  • A to G, chromosome 13 at 23,183,977 bp
  • G to T, chromosome 13 at 60,757,353 bp
  • A to C, chromosome 14 at 44,859,162 bp
  • G to A, chromosome 15 at 73,025,967 bp
  • T to C, chromosome 15 at 85,263,348 bp
  • T to A, chromosome 15 at 98,125,575 bp
  • T to A, chromosome 17 at 22,603,115 bp
  • C to A, chromosome 17 at 25,859,925 bp
  • T to A, chromosome 17 at 34,032,129 bp
  • G to A, chromosome 17 at 84,773,258 bp
  • A to G, chromosome 18 at 37,342,197 bp
  • C to A, chromosome 19 at 6,985,427 bp
  • A to T, chromosome 19 at 30,100,826 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2312 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040311-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.