Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1363Btlr/Mmmh
Stock Number:
039428-MU
Citation ID:
RRID:MMRRC_039428-MU
Other Names:
R1363 (G1), C57BL/6J-MtgxR1363Btlr
Major Collection:

Strain Information

Mcoln3
Name: mucolipin 3
Synonyms: varitint-waddler, Va, 6720490O21Rik, TRPML3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171166
Homologene: 10118
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Fancc
Name: Fanconi anemia, complementation group C
Synonyms: Facc
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14088
HGNC: HGNC:3584
Homologene: 109
Cct7
Name: chaperonin containing TCP1 subunit 7
Synonyms: Cctz, Ccth
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12468
HGNC: HGNC:1622
Homologene: 4694
Rps24
Name: ribosomal protein S24
Synonyms: MRP S24
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20088
VEGA: 14
Homologene: 68148
Gnat1
Name: G protein subunit alpha transducin 1
Synonyms: transducin, Tralpha, Gnat-1, Ird2, Ird1, irdr
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14685
HGNC: HGNC:4393
Homologene: 20084
Psmg2
Name: proteasome (prosome, macropain) assembly chaperone 2
Synonyms: 1700017I17Rik, Clast3, Tnfsf5ip1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107047
VEGA: 18
Homologene: 41354
Rnf6
Name: ring finger protein (C3H2C3 type) 6
Synonyms: 5730419H05Rik, 1200013I08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74132
Homologene: 14036
Plxna2
Name: plexin A2
Synonyms: OCT, Plxn2, 2810428A13Rik, PlexA2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18845
HGNC: HGNC:9100
Homologene: 56427
Dlk1
Name: delta like non-canonical Notch ligand 1
Synonyms: pref-1, pG2, ZOG, SCP1, FA1, Peg9, DlkI
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13386
HGNC: HGNC:2907
Homologene: 2846
Scyl3
Name: SCY1-like 3 (S. cerevisiae)
Synonyms: Pace1, 1200016D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240880
Homologene: 10706
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Stk33
Name: serine/threonine kinase 33
Synonyms: 4921505G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117229
Homologene: 75307
Vmn2r105
Name: vomeronasal 2, receptor 105
Synonyms: EG627743
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627743
Homologene: 129680
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Slc28a1
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 1
Synonyms: Cnt1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434203
Homologene: 37902
Poldip2
Name: polymerase (DNA-directed), delta interacting protein 2
Synonyms: 1300003F06Rik, mitogenin 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67811
Homologene: 9201
Ttbk2
Name: tau tubulin kinase 2
Synonyms: TTK, B930008N24Rik, 2610507N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Rasl10b
Name: RAS-like, family 10, member B
Synonyms: VTS58635, B230331P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276952
Homologene: 14108
Slc7a11
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms: System xc, xc, xCT, sut, 9930009M05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26570
Homologene: 22684
Gm4953
Name: predicted pseudogene 4953
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 240853
Cdc14a
Name: CDC14 cell division cycle 14A
Synonyms: CDC14A2, CDC14a1, Cdc14, A830059A17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229776
HGNC: HGNC:1718
Homologene: 75343
Ifi204
Name: interferon activated gene 204
Synonyms: p204
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15951
Homologene: 115929
Csf1r
Name: colony stimulating factor 1 receptor
Synonyms: CSF-1R, M-CSFR, CD115, Fim-2, Fms, Csfmr, Fim2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12978
HGNC: HGNC:2433
Homologene: 3817
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 82,287,288 bp
  • ATCCTCCTCCTCCTCCT to ATCCTCCTCCTCCT, chromosome 1 at 159,168,352 bp
  • A to G, chromosome 1 at 163,950,690 bp
  • C to T, chromosome 1 at 173,749,296 bp
  • C to A, chromosome 1 at 189,798,628 bp
  • C to T, chromosome 1 at 194,804,939 bp
  • T to C, chromosome 2 at 120,806,908 bp
  • T to C, chromosome 3 at 50,424,051 bp
  • CGCTGCTGCTGCTGCTGCTG to CGCTGCTGCTGCTGCTG, chromosome 3 at 116,293,860 bp
  • A to T, chromosome 3 at 146,137,577 bp
  • A to T, chromosome 5 at 146,211,559 bp
  • G to T, chromosome 6 at 85,466,035 bp
  • G to A, chromosome 7 at 81,122,233 bp
  • A to T, chromosome 7 at 109,279,821 bp
  • G to A, chromosome 8 at 123,304,281 bp
  • A to G, chromosome 9 at 107,677,623 bp
  • T to C, chromosome 11 at 78,519,377 bp
  • G to A, chromosome 11 at 83,417,839 bp
  • G to T, chromosome 12 at 109,455,504 bp
  • T to C, chromosome 13 at 63,361,598 bp
  • A to G, chromosome 14 at 24,491,762 bp
  • T to A, chromosome 17 at 20,208,670 bp
  • A to G, chromosome 18 at 61,124,845 bp
  • CTTCAGTT to CTTCAGTTCAGTT, chromosome 18 at 67,646,025 bp
  • T to A, chromosome 19 at 6,850,371 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1363 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039428-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.