Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1336Btlr/Mmmh
Stock Number:
039401-MU
Citation ID:
RRID:MMRRC_039401-MU
Other Names:
R1336 (G1), C57BL/6J-MtgxR1336Btlr
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Snx4
Name: sorting nexin 4
Synonyms: 1810036H14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69150
VEGA: 16
Homologene: 36143
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54447
VEGA: 19
Homologene: 10310
Rif1
Name: replication timing regulatory factor 1
Synonyms: 5730435J01Rik, 6530403D07Rik, D2Ertd145e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Chsy1
Name: chondroitin sulfate synthase 1
Synonyms: skt
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269941
Homologene: 8950
Osbpl7
Name: oxysterol binding protein-like 7
Synonyms: 4933437E18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71240
Homologene: 79672
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, 9430067K14Rik, Plekhm1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Cox16
Name: cytochrome c oxidase assembly protein 16
Synonyms: 1810055I05Rik, 1810020G14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66272
Homologene: 9520
Sh3bgrl2
Name: SH3 domain binding glutamic acid-rich protein like 2
Synonyms: A930014C21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 212531
Homologene: 12876
Mapk3
Name: mitogen-activated protein kinase 3
Synonyms: Erk-1, p44 MAP kinase, p44erk1, p44mapk, Prkm3, Erk1, Esrk1, Mtap2k
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26417
HGNC: HGNC:6877
Homologene: 55682
Emp2
Name: epithelial membrane protein 2
Synonyms: Xmp
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13731
HGNC: HGNC:3334
Homologene: 1089
Itga9
Name: integrin alpha 9
Synonyms: 2610002H11Rik, D9Ertd428e, 6720458D17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Bbs7
Name: Bardet-Biedl syndrome 7
Synonyms: 8430406N16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71492
Homologene: 12395
Pmfbp1
Name: polyamine modulated factor 1 binding protein 1
Synonyms: F77, 1700016D22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56523
Homologene: 23182
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Fgl2
Name: fibrinogen-like protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14190
HGNC: HGNC:3696
Homologene: 4864
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Fcrl6
Name: Fc receptor-like 6
Synonyms: FcRH6, ENSMUSG00000070504, moFcRH6, mIFGP6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 677296
Homologene: 88414
Papss2
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms: Sk2, Atpsk2, 1810018P12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23972
VEGA: 19
HGNC: HGNC:8604
Homologene: 55840
Ogfod1
Name: 2-oxoglutarate and iron-dependent oxygenase domain containing 1
Synonyms: 4930415J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270086
Homologene: 41238
Uck1
Name: uridine-cytidine kinase 1
Synonyms: URK1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22245
Homologene: 7990
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 64,937,781 bp
  • G to A, chromosome 1 at 172,599,224 bp
  • T to C, chromosome 2 at 32,259,654 bp
  • T to A, chromosome 2 at 52,078,314 bp
  • T to C, chromosome 2 at 77,014,440 bp
  • C to A, chromosome 2 at 120,673,636 bp
  • A to G, chromosome 3 at 36,604,444 bp
  • A to T, chromosome 4 at 11,276,901 bp
  • T to A, chromosome 5 at 21,373,183 bp
  • A to G, chromosome 5 at 96,707,308 bp
  • A to G, chromosome 7 at 27,417,963 bp
  • C to A, chromosome 7 at 66,125,239 bp
  • T to C, chromosome 7 at 126,763,869 bp
  • T to C, chromosome 8 at 94,058,099 bp
  • T to G, chromosome 8 at 109,530,266 bp
  • C to T, chromosome 9 at 83,577,631 bp
  • T to C, chromosome 9 at 118,689,429 bp
  • G to A, chromosome 10 at 52,168,662 bp
  • A to G, chromosome 11 at 97,052,472 bp
  • G to A, chromosome 11 at 108,192,227 bp
  • A to G, chromosome 11 at 118,043,215 bp
  • T to C, chromosome 12 at 81,472,290 bp
  • C to T, chromosome 13 at 89,693,055 bp
  • T to C, chromosome 16 at 10,284,619 bp
  • T to C, chromosome 16 at 33,280,680 bp
  • A to G, chromosome 19 at 32,044,941 bp
  • T to C, chromosome 19 at 32,638,315 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1336 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039401-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.