Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR0947Btlr/Mmmh
Stock Number:
039086-MU
Citation ID:
RRID:MMRRC_039086-MU
Other Names:
R0947 (G1), C57BL/6J-MtgxR0947Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Cd40
Name: CD40 antigen
Synonyms: Cd40, Bp50, p50, Tnfrsf5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21939
Homologene: 954
Aldh7a1
Name: aldehyde dehydrogenase family 7, member A1
Synonyms: Atq1, D18Wsu181e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110695
HGNC: HGNC:877
Homologene: 913
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Cwf19l2
Name: CWF19 like cell cycle control factor 2
Synonyms: 3230401L03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244672
Homologene: 12366
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Racgap1
Name: Rac GTPase-activating protein 1
Synonyms: MgcRacGAP, GTPase, Band25, gtl11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26934
HGNC: HGNC:9804
Homologene: 8077
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: ZF5, Zfp161, b2b1982Clo
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22666
Homologene: 2560
Atp6v1b1
Name: ATPase, H+ transporting, lysosomal V1 subunit B1
Synonyms: Vpp3, Vpp-3, Atp6b1, lysosomal 56/58kDa, D630039P21Rik, D630030L16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110935
HGNC: HGNC:853
Homologene: 68198
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Pbx1
Name: pre B cell leukemia homeobox 1
Synonyms: Pbx-1, D230003C07Rik, 2310056B04Rik, Pbx1a, Pbx1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18514
HGNC: HGNC:8632
Homologene: 20574
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Vps26b
Name: VPS26 retromer complex component B
Synonyms: 1810012I05Rik, 2310075A12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69091
VEGA: 9
Homologene: 3601
Zfp386
Name: zinc finger protein 386 (Kruppel-like)
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56220
Homologene: 51668
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hsh2d
Name: hematopoietic SH2 domain containing
Synonyms: ALX, Hsh2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 209488
Homologene: 13142
Ugcg
Name: UDP-glucose ceramide glucosyltransferase
Synonyms: GlcT-1, Epcs21, Ugcgl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22234
Homologene: 37763
Zfp804a
Name: zinc finger protein 804A
Synonyms: C630007C17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241514
Homologene: 18461
Zscan20
Name: zinc finger and SCAN domains 20
Synonyms: Zfp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269585
Homologene: 51463
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Man1a
Name: mannosidase 1, alpha
Synonyms: PCR1, mannosyl-oligosaccharide alpha-1,2-mannosidase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17155
HGNC: HGNC:6821
Homologene: 4316
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232970
Homologene: 109375
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627132
Homologene: 129750
Krt18
Name: keratin 18
Synonyms: K18, Endo B, Krt1-18, CK18
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16668
VEGA: 15
HGNC: HGNC:6430
Homologene: 55448
Glmn
Name: glomulin, FKBP associated protein
Synonyms: Fap68, Fap48, 9330160J16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170823
Homologene: 14239
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Or9i1b
Name: olfactory receptor family 9 subfamily I member 1B
Synonyms: GA_x6K02T2RE5P-4250267-4251217, MOR211-4P, MOR211-10_i, Olfr1505
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258151
Homologene: 17394
Spsb1
Name: splA/ryanodine receptor domain and SOCS box containing 1
Synonyms: 1110014L01Rik, SSB1, 4930422J18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74646
Homologene: 11832
Pcsk7
Name: proprotein convertase subtilisin/kexin type 7
Synonyms: SPC7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18554
VEGA: 9
HGNC: HGNC:8748
Homologene: 37955
Trim5
Name: tripartite motif-containing 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667823
Homologene: 75345
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: GA_x6K02T2PBJ9-10951546-10952496, MOR204-7, Olfr507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258738
Homologene: 27249
Sgk2
Name: serum/glucocorticoid regulated kinase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27219
Homologene: 8446
Rbks
Name: ribokinase
Synonyms: 5230400M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71336
Homologene: 5482
Lrrc32
Name: leucine rich repeat containing 32
Synonyms: D7H11S833E, D11S833Eh, Garp, EG434215
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434215
HGNC: HGNC:4161
Homologene: 4027
Gdpd1
Name: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: 2610020H15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66569
Homologene: 7069
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 168,203,366 bp
  • T to A, chromosome 1 at 175,775,749 bp
  • G to T, chromosome 2 at 69,487,838 bp
  • T to A, chromosome 2 at 76,885,230 bp
  • T to C, chromosome 2 at 82,258,718 bp
  • G to T, chromosome 2 at 127,538,263 bp
  • T to A, chromosome 2 at 163,006,838 bp
  • C to A, chromosome 2 at 165,063,574 bp
  • C to T, chromosome 4 at 59,207,798 bp
  • A to G, chromosome 4 at 128,604,191 bp
  • T to C, chromosome 4 at 149,907,079 bp
  • G to A, chromosome 5 at 31,666,927 bp
  • T to C, chromosome 5 at 34,898,924 bp
  • A to G, chromosome 5 at 107,593,740 bp
  • A to T, chromosome 6 at 83,753,832 bp
  • G to T, chromosome 7 at 24,623,968 bp
  • T to A, chromosome 7 at 97,669,778 bp
  • A to G, chromosome 7 at 98,498,883 bp
  • A to T, chromosome 7 at 104,265,751 bp
  • A to G, chromosome 7 at 108,622,672 bp
  • A to G, chromosome 7 at 128,175,693 bp
  • G to A, chromosome 8 at 72,200,460 bp
  • T to C, chromosome 9 at 3,421,286 bp
  • T to C, chromosome 9 at 27,012,781 bp
  • G to T, chromosome 9 at 45,911,172 bp
  • A to G, chromosome 9 at 53,504,092 bp
  • A to C, chromosome 9 at 53,570,324 bp
  • A to T, chromosome 9 at 67,295,813 bp
  • A to T, chromosome 9 at 95,998,263 bp
  • G to A, chromosome 9 at 110,548,511 bp
  • CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC to CCTGTCCCTGCTGTCCCTGCTGTCCCTGCTGTCC, chromosome 10 at 53,537,501 bp
  • A to T, chromosome 10 at 53,933,523 bp
  • T to G, chromosome 11 at 87,037,881 bp
  • A to T, chromosome 12 at 70,061,186 bp
  • T to C, chromosome 12 at 116,059,778 bp
  • C to T, chromosome 15 at 99,624,314 bp
  • A to G, chromosome 15 at 102,030,728 bp
  • A to T, chromosome 17 at 18,304,081 bp
  • C to A, chromosome 17 at 46,941,112 bp
  • C to A, chromosome 17 at 69,388,502 bp
  • A to T, chromosome 18 at 56,560,838 bp
  • T to A, chromosome 19 at 13,919,171 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0947 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039086-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.