The live colony for this line will soon be taken off the shelf. Once off the shelf, this line will only be available as cryopreserved germplasm or mice from cryo recovery. Place your orders online by 05/31/2024 to receive mice from the live colony.

Strain Name:
C57BL/6NJ-Eml3em1(IMPC)J/Mmjax
Stock Number:
068328-JAX
Citation ID:
RRID:MMRRC_068328-JAX
Major Collection:

Strain Information

Eml3em1(IMPC)J
Name: echinoderm microtubule associated protein like 3; endonuclease-mediated mutation 1, Jackson
Type: Allele
Species: Mus musculus
Chromosome:
Alteration at locus: CRISPR
Eml3
Name: echinoderm microtubule associated protein like 3
Type: Gene
Species: Mus musculus
Chromosome: 19
Alteration at locus: CRISPR
NCBI: 225898
VEGA: 19
Homologene: 27044
Genetic Alterations
intragenic deletion
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain Development
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGTCAGCCTGCTAATGTG and GAACTACAGGAGTTCTAACG, which resulted in a 2241 bp deletion beginning at Chromosome 19 position 8,932,972 bp and ending after 8,935,212 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621540, ENSMUSE00000621539, ENSMUSE00000621538, ENSMUSE00000621537, ENSMUSE00000621536, and ENSMUSE00000621535 (exons 5-10) and 1601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 189 and early truncation 127 amino acids later.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
Donor
Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information

Coat Color
black
Generation
N2F2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined
Heterozygotes are fertile: Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Average Pups Weaned
Undetermined

Order Request Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

The live colony for this line will soon be taken off the shelf. Once off the shelf, this line will only be available as cryopreserved germplasm or mice from cryo recovery. Place your orders online by 05/31/2024 to receive mice from the live colony.

MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068328-JAX-HET-F
068328-JAX-HET-M
068328-JAX-WT-F
068328-JAX-WT-M
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
$218.00 / $218.00
Non-Profit / For-Profit
Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.